Microascus brevicaulis

S.P.Abbott · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Microascales/Microascaceae/Microascus

At a glance

Occurrence records40

Data sources10

Biological traits0

DNA specimens0

eDNA detections1 033

Sources10 archives

Databases and archives Microascus brevicaulis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 033 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF40 records

Environmental DNA7 datasets · 22 countries1 033 detections

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈34 Mbp

01Narrative

Microascus brevicaulis is a microfungus in the Ascomycota.Kirk et al., p. 55. It is the teleomorph form of Scopulariopsis brevicaulis. Microascus brevicaulis occurs world-wide as a saprotroph in soil, a common agent of biodeterioration, an irregular plant pathogen, and an occasional agent of human nail infection.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition7 compounds

Compounds documented for Microascus brevicaulis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cyclic peptides $ Depsipeptides $ Lipopeptides8

Cycloartane triterpenoids1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,6S,9R,12S,19S)-3-benzyl-19-[(2S)-hexan-2-yl]-6-methyl-9-(2-methylpropyl)-12-propan-2-yl-1-oxa-4,7,10,13,16-pentazacyclononadecane-2,5,8,11,14,17-hexone	present	LOTUS
(3S,6S,9R,12S,19S)-3-benzyl-19-decan-2-yl-6-methyl-9-(2-methylpropyl)-12-propan-2-yl-1-oxa-4,7,10,13,16-pentazacyclononadecane-2,5,8,11,14,17-hexone	present	LOTUS
(3S,6S,9R,12S,19S)-3-benzyl-6-methyl-9-(2-methylpropyl)-19-[(2R)-octan-2-yl]-12-propan-2-yl-1-oxa-4,7,10,13,16-pentazacyclononadecane-2,5,8,11,14,17-hexone	present	LOTUS
CID 156583056	present	LOTUS
Nigranoic Acid	present	NPASS
Scopularide A	present	LOTUS
Scopularide B	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Microascus brevicaulis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections1 033

Countries22

The DNA barcodea real sequence read deposited for this species

ITSPZ135088.1 ↗383 bpPoland · 2022

ACGT

TGATTCAAAACAAAAAACAAGTCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA …

Scopulariopsis brevicaulis isolate UWR_1165 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Microascus brevicaulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 797 795 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Microascus brevicaulis0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness94.1% BUSCO

08Occurrence & distribution

Record type40 records

Wild obs. + sensor4

Museum / vouchered32

Other4

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	3
Philadelphia, US	2
Tartu, EE	1
Museo Entomologico de Leonlocation not on record	1
Helsinki, FI	1

5 institutions · 8 of 32 vouchered records shown · 24 without an institution code

09Environmental DNA1 033 detections

Where the DNA of Microascus brevicaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 033

Studies independent surveys7

Countries22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 033 detections have coordinates

Open the map22 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.40 5.20–5.60

Conductivity78.0 µS/cm 75.0–81.0

Organic carbon3.58 % 3.40–3.75

Water content24.5 % 23.2–25.8

Phosphorus32.0 mg/kg 13.0–51.0

Clay16.6 % 16.3–16.9

Sand65.6 % 61.9–69.4

Depth0 m

SoilTenosols

2 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 6.10–17.2

Seasonal swing summer↔winter22.4 °C

Max temp (day)15.4 °C 8.80–20.8

Min temp (night)9.10 °C 3.00–14.2

Precipitation72.8 mm/mo 55.7–109

Air humidity62.2 % 57.4–65.5

Moisture balance4.10 mm/mo -46.2–77.7

Vapour deficit535 Pa 339–770

Wind speed3.30 m/s 2.30–4.50

Cloud cover43.7 % 35.8–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 1 017 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)