Micranthus tubulosus

(Burm.f.) N.E.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Micranthus

At a glance

Occurrence records507

Data sources5

Biological traits15

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Micranthus tubulosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility507 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF507 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Micranthus tubulosus là một loài thực vật có hoa trong họ Diên vĩ. Loài này được (Burm.f.) N.E.Br. miêu tả khoa học đầu tiên năm 1929.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.15 m

Life cycle & reproduction3

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 065 m

Elevation min30 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micranthus tubulosus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPQ191140.1 ↗1 341 bpUSA · 2023

ACGT

ATGTCACCACAAACAGAGACTAAAGCAAGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAA …

Micranthus tubulosus voucher 96.0411 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Micranthus tubulosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — GOLDBLATT, P. 1971. Cytological and morphological studies in the Southern African Iridaceae. J.S. African Bot. 37: 317-460.

08Occurrence & distribution

Record type507 records

Wild obs. + sensor431

Museum / vouchered76

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 318≤1 km 32≤10 km 7>10 km 16

373 georeferenced · 58 without coordinates

Open the mapobservation + sensor431

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	24
Cape Town, ZA	22
Cape Town, ZA	14
Saint Louis, US	7
GHPG$location not on record	2
Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record	2
MSB-3054location not on record	1
Philadelphia, US	1
South African National Biodiversity Institutelocation not on record	1
Moscow State Universitylocation not on record	1
Madison, US	1

11 institutions · 76 of 76 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)