Micrantheum hexandrum

Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Picrodendraceae/Micrantheum

At a glance

Occurrence records1 380

Data sources6

Biological traits40

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Micrantheum hexandrum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Occurrence & distributionGBIF1 380 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Micrantheum hexandrum là một loài thực vật có hoa trong họ Picrodendraceae. Loài này được Hook.f. mô tả khoa học đầu tiên năm 1847.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length6.5 mm

Fruit width6 mm

Leaf length15 mm

Leaf length max15 mm

Leaf length min8 mm

Leaf size35.34 mm²

Leaf width3 mm

Leaf width max3 mm

Leaf width min2 mm

Petiole length0.1 cm

Plant height2 m

Plant height max2 m

Seed length3.85 mm

Seed mass5.71 mg

Seed mass max5.71 mg

Seed mass min5.71 mg

Seed width1.4 mm

Life cycle & reproduction9

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_oblanceolate oblanceolate oblong

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micrantheum hexandrum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLAJ418816.1 ↗1 408 bp

ACGT

TAAAGCAAGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATATT …

Micrantheum hexandrum plastid partial rbcL gene for rubisco large subunit

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type1 380 records

Wild obs. + sensor727

Museum / vouchered653

Origin

Native101

Range

Area of Occupancy AOO2 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 420≤1 km 151≤10 km 107>10 km 4

682 georeferenced · 45 without coordinates

Open the mapobservation + sensor727

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 51≤1 km 234≤10 km 253>10 km 38

576 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence653

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	156
Hobart, AU	123
Canberra, AU	117
Mount Annan, AU	102
Brisbane, AU	48
Armidale, AU	23
Adelaide, AU	21
QVMAGlocation not on record	18
Kew, GB	12
Parkville, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Wollongong, AU	4
Wellington, NZ	2
Batemans Bay, AU	2
Stockholm, SE	1
Kensington, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Fort Worth, US	1
Minia, EG	1
Madison, US	1
La Trobe Universitylocation not on record	1
Palmerston, AU	1

22 institutions · 645 of 653 vouchered records shown · 8 without an institution code

09Environmental DNA2 detections

Where the DNA of Micrantheum hexandrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Micrantheum hexandrum

At a glance

Sources6 archives

Size & morphology17

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 380 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 380 records