Micrantheum ericoides

Desf. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Picrodendraceae/Micrantheum

At a glance

Occurrence records2 284

Data sources7

Biological traits43

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Micrantheum ericoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 284 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF2 284 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Micrantheum ericoides is an inconspicuous shrub growing on poor sandy soils in eastern Australia. Often seen in areas of mid to relatively high rainfall. Usually seen between 20 and 80 cm high. Flowers are tiny, white or pink occurring between August and November. However, the plant may be noticed by the red fruit capsules. The specific epithet ericoides refers to a similarity to the European heath, or Erica.Les Robinson - Field Guide to the Native Plants of Sydney, page 166 This plant first appeared in scientific literature in 1818, published by the French botanist René Louiche Desfontaines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length6.5 mm

Fruit width4 mm

Leaf length7 mm

Leaf length max10 mm

Leaf length min4 mm

Leaf mass1 mg

Leaf mass per area108 g/m2

Leaf size5.3 mm²

Leaf width1.4 mm

Leaf width max1.5 mm

Leaf width min1 mm

Plant height0.5 m

Seed mass2.81 mg

Seed mass max2.8 mg

Seed mass min2.65 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life formshrub

Life spanperennial

Lifespan years100 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity2.5 years

Resprouting capacityfire_killed

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical

Woodinesswoody

Physiology & chemistry5

Leaf dry-matter content (LDMC)364 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.65 mm²/mg

Wood density760 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micrantheum ericoides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594306.1 ↗592 bpAustralia · 2017

ACGT

GACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTAT …

Micrantheum ericoides voucher 600300335 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type2 284 records

Wild obs. + sensor1 950

Museum / vouchered320

Cultivated / captive2

Other12

Origin

Native110

Range

Area of Occupancy AOO3 076 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 535≤1 km 233≤10 km 74>10 km 14

1 856 georeferenced · 94 without coordinates

Open the mapobservation + sensor1 950

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 57≤1 km 53≤10 km 140>10 km 23

273 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence320

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	110
Brisbane, AU	79
Canberra, AU	41
Museo Entomologico de Leonlocation not on record	27
Armidale, AU	14
Adelaide, AU	10
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Kew, GB	9
John T. Waterhouse Herbariumlocation not on record	5
Wollongong, AU	4
Beijing, CN	1
Bronx, US	1
IPA/SPlocation not on record	1
Hobart, AU	1
University of the Sunshine Coastlocation not on record	1

15 institutions · 313 of 320 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Micrantheum ericoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 22.5–22.5

Seasonal swing summer↔winter8.90 °C

Max temp (day)25.2 °C

Min temp (night)19.9 °C

Precipitation131 mm/mo

Air humidity59.4 %

Moisture balance-62.4 mm/mo

Vapour deficit1,103 Pa

Wind speed5.30 m/s

Cloud cover20.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Micrantheum ericoides

At a glance

Sources7 archives

Size & morphology15

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry5

At a glance

Record type2 284 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 15 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 284 records