Micranthes rufidula

Small · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Saxifragaceae/Micranthes

At a glance

Occurrence records850

Data sources8

Biological traits9

DNA specimens5

eDNA detections3

Sources8 archives

Databases and archives Micranthes rufidula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility850 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF850 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Micranthes rufidula is a species of flowering plant known by the common name rustyhair saxifrage. It is native to western North America from British Columbia to Oregon, and one location in northern California. It grows in moist, open and rocky habitat in mountainous areas. It is a perennial herb growing from a small caudex and system of rhizomes. The leaves have oval blades lined with blunt teeth borne on long petioles. The inflorescence arises on a hairy peduncle, the flowers bearing white petals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micranthes rufidula has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG235148.1 ↗351 bpCanada · 2012

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTCTGGTTAAGGGCACGTCTGCCTGGGCGTCACGTACAC …

Micranthes rufidula voucher MF52 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type850 records

Wild obs. + sensor732

Museum / vouchered118

Range

Area of Occupancy AOO1 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 478≤1 km 59≤10 km 18>10 km 19

574 georeferenced · 158 without coordinates

Open the mapobservation + sensor732

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 10≤1 km 33≤10 km 33>10 km 1

77 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	57
Vancouver, CA	26
WTUlocation not on record	12
Portland, US	8
Pullman, US	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
DOI/NPS, Mount Rainier National Parklocation not on record	2
Mississippi State, US	1
Wuzhou, CN	1
Whitehorse, CA	1
Portland, US	1
Moscow State Universitylocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
University of British Columbia, Herbariumlocation not on record	1

14 institutions · 117 of 118 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Micranthes rufidula was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 11.0–11.0

Seasonal swing summer↔winter8.50 °C

Max temp (day)12.8 °C

Min temp (night)9.80 °C

Precipitation37.9 mm/mo

Air humidity61.6 %

Vapour deficit502 Pa

Cloud cover43.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)