Micranthes nelsoniana

(D.Don) Small · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Saxifragaceae/Micranthes

At a glance

Occurrence records1 016

Data sources8

Biological traits24

DNA specimens31

eDNA detections20

Sources8 archives

Databases and archives Micranthes nelsoniana's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 016 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

giftgenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources24 traits

Occurrence & distributionGBIF1 016 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD · NCBI31 specimens

Genome at a glanceGoaTgenome

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Leaf size737 mm²

Plant height0.076 m

Plant height generative0.294 m

Plant height max0.5 m

Plant height min0.1 m

Seed mass0.042 mg

Seed mass max0.067 mg

Seed mass min0.032 mg

Life cycle & reproduction5

Flowering endJul

Flowering startJul

Life formperennial or rhizomatous geophyte

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows, mountains, rivers, stony places

Woodinessnon-woody

Physiology & chemistry3

Leaf c404 mg/g

Leaf dry-matter content (LDMC)263 mg/g

Specific leaf area (SLA)14.82 mm²/mg

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micranthes nelsoniana has left across the world's sequence archives.

At a glance

DNA specimens31

Marker genes5

GenBank sequences10

eDNA detections20

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG237293.1 ↗303 bpCanada · 1975

ACGT

GAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGTACACACTTCTCCCACAAACCTTTCC …

Micranthes nelsoniana voucher CCDB-18357-G6 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcLa★ITS8★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Micranthes nelsoniana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type1 016 records

Wild obs. + sensor779

Museum / vouchered237

Range

Area of Occupancy AOO3 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 411≤1 km 112≤10 km 36>10 km 7

566 georeferenced · 213 without coordinates

Open the mapobservation + sensor779

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 6≤1 km 17≤10 km 18>10 km 11

52 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence237

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pullman, US	84
University of Stellenboschlocation not on record	50
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	18
Chongqing Museumlocation not on record	16
Research Collection of B. A. Bennettlocation not on record	11
Anchorage, US	10
Victoria, CA	8
Durham, US	4
Corvallis, US	4
Tempe, US	4
St. Paul, US	4
Vancouver, CA	3
Albuquerque, US	2
National Institute of Biological Resourceslocation not on record	2
Portland, US	2
Bloomington, US	2
Provo, US	1
Dekalb, US	1
Davis, US	1
Lord Fairfax Community Collegelocation not on record	1
DULlocation not on record	1

21 institutions · 229 of 237 vouchered records shown · 8 without an institution code

09Environmental DNA20 detections

Where the DNA of Micranthes nelsoniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

Cottongrass TussocksCushion Shrub (Salix polaris) - Moss Snowbank

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 4.40–15.8

Seasonal swing summer↔winter32.9 °C

Max temp (day)15.2 °C 7.80–19.9

Min temp (night)7.00 °C 0.6–11.1

Precipitation90.9 mm/mo 50.1–163

Air humidity60.6 % 57.2–65.9

Moisture balance0.9 mm/mo -51.6–73.7

Vapour deficit531 Pa 308–722

Wind speed3.50 m/s 2.20–8.40

Cloud cover45.2 % 41.3–71.9

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Micranthes nelsoniana

At a glance

Sources8 archives

Size & morphology8

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 016 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 016 records