Micranthes micranthidifolia

(Haw.) Small · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Saxifragaceae/Micranthes

At a glance

Occurrence records1 310

Data sources9

Biological traits9

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Micranthes micranthidifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF1 310 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Micranthes micranthidifolia is a member of the Saxifrage family with the common names lettuceleaf saxifrage, branch lettuce and brook lettuce. It grows in wet areas and mountain streams. It is a native plant of the Great Smoky Mountains and occurs in many other parts of the southeastern United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micranthes micranthidifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK676020.1 ↗665 bp

ACGT

CTGAACCTGCATGCAGAAACCTTGAGAACATGTTAAAAAAAATTGAGGAGGGGCATTTCATGTTTCTTCTCACATCTTTGTGGGGAGTCA …

Micranthes micranthidifolia voucher ML 2008a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Micranthes micranthidifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Soltis, D. E. & B. D. Ness. 1986. Chromosome Number Reports 91. Taxon 35: 408–409.

CCDB · eflora

CCDB · book-atlas-flowering-plants — Skovsted 1934b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.932 ↗

08Occurrence & distribution

Record type1 310 records

Wild obs. + sensor1 185

Museum / vouchered125

Range

Area of Occupancy AOO2 532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 632≤1 km 121≤10 km 74>10 km 145

972 georeferenced · 213 without coordinates

Open the mapobservation + sensor1 185

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 14≤1 km 27≤10 km 47>10 km 7

95 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	54
Chapel Hill, US	25
Pullman, US	9
Maryland Department of Natural Resourceslocation not on record	6
Bloomington, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Johnson City, US	4
Norfolk, US	2
Durham, US	2
Asheville, US	2
Appalachian State Universitylocation not on record	2
Tampa, US	1
Auckland, NZ	1
Canadian Department of Agriculturelocation not on record	1
Valdosta State Universitylocation not on record	1

15 institutions · 121 of 125 vouchered records shown · 4 without an institution code

09Environmental DNA3 detections

Where the DNA of Micranthes micranthidifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Micranthes micranthidifolia

At a glance

Sources9 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 310 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 310 records