Miconia prasina
(Sw.) DC. · speciesAt a glance
Occurrence records5 987
Data sources11
Biological traits32
DNA specimens10
eDNA detections6
Sources11 archives
Databases and archives Miconia prasina's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 987 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics10 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources32 traits
Chemical compositionLOTUS2 compounds
Occurrence & distributionGBIF5 987 records
Environmental DNA1 datasets · 3 countries6 detections
DNA & barcodingBOLD · NCBI10 specimens
Genome at a glanceGoaTgenome
01Narrative
Miconia prasina est une espèce de plantes à fleurs de la famille des Melastomataceae. C'est un arbuste ou un peit arbre originaire d'Amérique du Sud.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology6
Leaf size12 808 mm²
Plant height10 m
⚠ sources differ — GIFT: 10 m · TRY: 7.62 m
Plant height max15 m
Seed length max6 mm
Seed length min1 mm
Seed mass0.81 mg
Life cycle & reproduction5
Deciduousnessevergreen
Life formtree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 700 m
Elevation min0 m
Epiphyteterrestrial
Growth formtree
Habitat GIFTÁrea Antrópica, Floresta Ciliar ou Galeria, Floresta de Terra Firme, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga
Woodinesswoody
Physiology & chemistry11
Ldmc max385 mg/g
Ldmc min385 mg/g
Leaf C:N ratio24.79 g/g
Leaf c458 mg/g
Leaf dry-matter content (LDMC)338 mg/g
⚠ sources differ — TRY: 338 mg/g · GIFT: 385 mg/g
Leaf n19.56 mg/g
Leaf p0.903 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)15.75 mm²/mg
Wood density641 mg/cm³
03Chemical composition2 compounds
Compounds documented for Miconia prasina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Gallotannins2
Documented compounds2 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3-Methylellagic acid | present | LOTUS | |
| Ellagic acid | present | LOTUS |
05DNA & barcoding10 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Miconia prasina has left across the world's sequence archives.
At a glance
DNA specimens10
Marker genes5
GenBank sequences9
eDNA detections6
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCAAATCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGCCTGCCTGGGCGTCGTGAATC …
Miconia prasina voucher STRI:Corteva-SJWright-RS00239 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★ITS5trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGoaT
The complete instruction manual Miconia prasina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Ploidypolyploid inferred
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 987 records
Wild obs. + sensor1 241
Museum / vouchered4 736
Other10
Origin
Native1 023
Range
Area of Occupancy AOO10 324 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 346≤1 km 27≤10 km 23>10 km 49
445 georeferenced · 796 without coordinates
Open the mapobservation + sensor1 241
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 86≤1 km 55≤10 km 108>10 km 27
276 georeferenced · 4 460 without coordinates
Open the institutions mapphysical evidence4 736
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions77 of 198 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 697 |
| Bronx, US | 654 |
| University of Stellenboschlocation not on record | 271 |
| JBRJlocation not on record | 185 |
| CASlocation not on record | 149 |
| Chaguaramas, TT | 145 |
| National Biodiversity Institute, Costa Ricalocation not on record | 140 |
| UFBAlocation not on record | 139 |
| UFPRlocation not on record | 129 |
| Salvador, BR | 104 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 84 |
| Chicago, US | 83 |
| Kew, GB | 78 |
| Universidad de Antioquia (UdeA)location not on record | 75 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 62 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 62 |
| CEPLAClocation not on record | 61 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 57 |
| Laboratorio de Ictiologialocation not on record | 53 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 53 |
| Mexico City, MX | 53 |
| UFRPElocation not on record | 51 |
| Universidad Nacional de Colombia (UNAL)location not on record | 50 |
| Paris, FR | 46 |
| Museu Paraense Emílio Goeldilocation not on record | 40 |
| UNICAMPlocation not on record | 38 |
| St. Augustine, TT | 36 |
| INMAlocation not on record | 35 |
| Durango, MX | 32 |
| UFPElocation not on record | 32 |
| UFRRJlocation not on record | 31 |
| Feira de Santana, BR | 31 |
| Departamento de Sistematica e Ecologialocation not on record | 29 |
| Masindi, UG | 26 |
| Universidade Federal de Sergipe (UFS)location not on record | 25 |
| Cenargenlocation not on record | 23 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 23 |
| HUAlocation not on record | 22 |
| Universidade Federal do Espírito Santolocation not on record | 21 |
| Stockholm, SE | 20 |
| Brasília, BR | 18 |
| Tampa, US | 16 |
| UERJlocation not on record | 16 |
| Ivano-Frankivsk, UA | 16 |
| Ural Federal University "B. N. Yeltsin"location not on record | 16 |
| MAlocation not on record | 15 |
| USP-IBlocation not on record | 15 |
| UFMGlocation not on record | 14 |
| Antiguo Cuscatlán, SV | 14 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 14 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 14 |
| Berlin, DE | 13 |
| UESBlocation not on record | 12 |
| UNESP-IBILCElocation not on record | 12 |
| Altos de Pipe, VE | 12 |
| IPA/SPlocation not on record | 11 |
| UnBlocation not on record | 10 |
| UFESlocation not on record | 10 |
| Austin, US | 10 |
| Xiamen, CN | 10 |
| Mérida, MX | 10 |
| Federal University of Espírito Santolocation not on record | 10 |
| Brasília, BR | 10 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 10 |
| Aarhus, DK | 9 |
| Ilhéus, BR | 9 |
| UFSClocation not on record | 9 |
| UEPAlocation not on record | 9 |
| Cruz das Almas, BR | 8 |
| León, NI | 8 |
| San José, CR | 8 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 8 |
| UFMSlocation not on record | 8 |
| Miami, US | 8 |
| Universidade Federal de Santa Catarinalocation not on record | 7 |
| Cuiabá, BR | 7 |
| Chongqing Museumlocation not on record | 7 |
| HUENFlocation not on record | 7 |
| QCNElocation not on record | 7 |
| Universidad de Nariño (UdeNar)location not on record | 6 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 6 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 6 |
| Loja, EC | 6 |
| ASUlocation not on record | 6 |
| San Francisco, US | 6 |
| UNIVASFlocation not on record | 6 |
| ESALQlocation not on record | 5 |
| Fortaleza, BR | 5 |
| UNEMATlocation not on record | 5 |
| PUC-RIOlocation not on record | 5 |
| Universidad Industrial de Santander (UIS)location not on record | 5 |
| Universiti Sains Malaysialocation not on record | 5 |
| Ann Arbor, US | 5 |
| Santa Cruz de la Sierra, BO | 5 |
| Chapel Hill, US | 4 |
| UNISANTAlocation not on record | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| Montréal, CA | 4 |
| Cambridge, US | 4 |
| Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record | 4 |
| Blumenau, BR | 4 |
| UFSCarlocation not on record | 4 |
| Edinburgh, GB | 4 |
| Kunming, CN | 4 |
| MeiseBGlocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| UFOPlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Uberlândia, BR | 3 |
| UNESP-ISlocation not on record | 3 |
| UNESP, Campus São José Rio Prêtolocation not on record | 3 |
| EL PASO, US | 3 |
| Santarém, BR | 3 |
| Cochabamba, BO | 3 |
| BMlocation not on record | 3 |
| Dublin, IE | 3 |
| Wlocation not on record | 3 |
| MEDELlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| NHMJlocation not on record | 3 |
| UNICAPlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Seropédica, BR | 3 |
| Universidad del Valle (UV)location not on record | 3 |
| MEXUlocation not on record | 3 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 3 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 2 |
| UEMlocation not on record | 2 |
| FLASlocation not on record | 2 |
| Chapingo, MX | 2 |
| La Paz, BO | 2 |
| CPATSAlocation not on record | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| arosemena tola, EC | 2 |
| Jardim Botânico do Rio de Janeirolocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| Fredericksburg, US | 2 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 2 |
| Quito, EC | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| Tapachula, MX | 2 |
| Madison, US | 2 |
| Tuscaloosa, US | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Porto Velho, BR | 2 |
| South Kensington, GB | 2 |
| Cambridge, US | 2 |
| Anton de Kom University of Surinamelocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Pittsburg, US | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Durham, US | 1 |
| Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record | 1 |
| Durham, US | 1 |
| Lima, PE | 1 |
| UFPIlocation not on record | 1 |
| Elocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Corrientes, AR | 1 |
| Davis, US | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Iquitos, PE | 1 |
| Uppsala, SE | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Toronto, CA | 1 |
| Bloomington, US | 1 |
| BAYLUlocation not on record | 1 |
| Phoenix, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| LDlocation not on record | 1 |
| Instituto Amazonico de Investigaciones Cientificas Sinchilocation not on record | 1 |
| Taipei, TW | 1 |
| Guatemala City, GT | 1 |
| UNIVILLElocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Londrina, BR | 1 |
| VALElocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| OTSlocation not on record | 1 |
| WTUlocation not on record | 1 |
| IAPlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| URCAlocation not on record | 1 |
| Riverside, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
198 institutions · 4 659 of 4 736 vouchered records shown · 76 without an institution code
09Environmental DNA6 detections
Where the DNA of Miconia prasina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.5 °C 17.6–23.8
Seasonal swing summer↔winter1.60 °C
Max temp (day)22.7 °C 20.9–27.5
Min temp (night)16.7 °C 14.2–20.6
Precipitation522 mm/mo 221–642
Air humidity70.8 % 67.7–70.9
Moisture balance423 mm/mo 62.0–534
Vapour deficit659 Pa 588–971
Wind speed0.9 m/s 0.5–2.10
Cloud cover44.6 % 31.2–67.8
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.