Miconia crenata

(Vahl) Michelang. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Melastomataceae/Miconia

At a glance

Occurrence records6 466

Data sources11

Biological traits35

DNA specimens0

eDNA detections4

Sources11 archives

Databases and archives Miconia crenata's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 466 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF6 466 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 34

01Narrative

Miconia crenata,Judd, W. S., Ionta, G. M., Majure, L. C., & Michelangeli, F. A. (2018). Taxonomic and nomenclatural notes on Miconia crenata and related species (Melastomataceae: Miconieae) in the Greater Antilles. Journal of the Botanical Research Institute of Texas, 12(2), 521-529.. Web. https://journals.brit.org/jbrit/article/view/955. (syn. Clidemia hirta), commonly called soapbush, clidemia or Koster's curse, is a perennial shrub. It is an invasive plant species in many tropical regions of the world, creating serious damage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Leaf length107 mm

Leaf width54 mm

Plant height1.2 m

⚠ sources differ — GIFT: 1.2 m · TRY: 0.521 m

Seed length0.2 mm

Seed mass0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Seed volume0.003 mm³

Seed volume max0.005 mm³

Seed volume min0.001 mm³

Seed width max0.1 mm

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 300 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Floresta de Igapó, Floresta de Terra Firme, Floresta Ombrófila (= Floresta Pluvial), Savana Amazônica

Mycorrhiza type0.0000000989

Woodinesswoody

Physiology & chemistry6

Leaf C:N ratio18.11 g/g

Leaf c460 mg/g

Leaf n17.1 mg/g

Leaf p0.8 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)22.52 mm²/mg

Other traits2

Leaf thickness0.016 mm

Seed height max0.1 mm

03Chemical composition2 compounds

Compounds documented for Miconia crenata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile1 class

Gallotannins2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-Methylellagic acid		present	LOTUS
Ellagic acid		present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Miconia crenata has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections4

Countries4

The DNA barcodea real sequence read deposited for this species

ITSOM812000.1 ↗504 bpIndonesia

ACGT

CATGGGGCTCGCGTCGCGTCGGCGCGGGTGTCCTCGAGACCCGCGTCGTACCGGCGGACAAACAATGTCAGCACGGATCGTGCCAAGGAG …

Miconia crenata voucher S0015 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Miconia crenata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 172×CCDB · ipcn-api-dl · CCDB · Cave1963

CCDB · ipcn-api-dl — Meenakumari, R. & P. Kuriachan. 1990. SOCGI plant chromosome number reports---X. J. Cytol. Genet. 25: 321–322.

CCDB · Cave1963 — Favarger 1962b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 466 records

Wild obs. + sensor5 983

Museum / vouchered483

Origin

Native2

Introduced175

Range

Area of Occupancy AOO11 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 3 199≤1 km 624≤10 km 311>10 km 322

4 456 georeferenced · 1 527 without coordinates

Open the mapobservation + sensor5 983

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 5≤1 km 1≤10 km 3

9 georeferenced · 474 without coordinates

Open the institutions mapphysical evidence483

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFPRlocation not on record	114
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	84
Paris, FR	36
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	35
St. Augustine, TT	35
JBRJlocation not on record	23
Blumenau, BR	22
Bronx, US	12
University of Stellenboschlocation not on record	10
Campo Mourão, BR	8
UTFPR-CPlocation not on record	8
BISHlocation not on record	5
Kew, GB	4
San José, CR	4
Clemson, US	4
HAWlocation not on record	3
UFSClocation not on record	3
Saint Louis, US	3
UFAClocation not on record	2
Masindi, UG	2
Loja, EC	2
UFRRJlocation not on record	2
Altos de Pipe, VE	2
Laboratorio de Ictiologialocation not on record	2
CJBGlocation not on record	2
Dekalb, US	1
Berlin, DE	1
INMAlocation not on record	1
HACAMlocation not on record	1
Universidade Federal de Santa Catarinalocation not on record	1
Universidade Federal do Espírito Santolocation not on record	1
Universidad de los Llanos (UniLlanos)location not on record	1
Pittsburg, US	1
Porto Velho, BR	1
UTFPR-DVlocation not on record	1
UNESP-FCAlocation not on record	1
PUC-RIOlocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1
Cruz das Almas, BR	1

39 institutions · 441 of 483 vouchered records shown · 42 without an institution code

09Environmental DNA4 detections

Where the DNA of Miconia crenata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C

Min temp (night)22.6 °C

Precipitation269 mm/mo

Air humidity68.1 %

Moisture balance133 mm/mo

Vapour deficit1,080 Pa

Wind speed1.20 m/s

Cloud cover57.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Miconia crenata

At a glance

Sources11 archives

Size & morphology11

Life cycle & reproduction4

Diet & foraging1

Habitat & environment11

Physiology & chemistry6

Other traits2

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 466 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 466 records