Micaria longipes

Emerton, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Gnaphosidae/Micaria

At a glance

Occurrence records88

Data sources9

Biological traits6

DNA specimens9

eDNA detections9

Sources9 archives

Databases and archives Micaria longipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

World Spider Trait DBMasaryk University6 traits · 3 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Micaria longipes is a species of ground spider in the family Gnaphosidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014bPekár 2014aPlatnick & Dondale 1992

Morphometry4

Body length♀4.94·♂4.22 mm

Cephalothorax length♀2.05·♂1.97 mm

Cephalothorax width♀1.19·♂1.13 mm

Femur II length♀1.24·♂1.3 mm

Ecology1

Circadian activitydiurnal

Defence1

Primary defenceBatesian mimicry

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Micaria longipes has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

73Amostly conserved

178Gvariable

220Amostly conserved

232Tmostly conserved

238Amostly conserved

364Cvariable

427Amostly conserved

523Tmostly conserved

TTTATATTTGATTTTTGGTGCGTGGGCTGCTATAGTGGGTACAGCAATGAGAGTATTAATTCGTATGGAGTTAGGACAGTCAGGTAGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.55%

Haplotypes3

BIN1

Most divergent pair0.77%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Zelotes lightfootisame family11.4%Micaria igneasame genus11.9%Asemesthes subnubilussame family12.6%Asemesthes reflexussame family12.9%Drassodes villosussame family13.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type88 records

Wild obs. + sensor2

Museum / vouchered86

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 1≤1 km 13≤10 km 17>10 km 2

33 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	26
Champaign, US	23
Denver, US	13
Royal Saskatchewan Museumlocation not on record	7
Ohio State University Acarology Laboratorylocation not on record	6
Royal British Columbia Museumlocation not on record	3
Cambridge, US	2
College Station, US	2
Chicago, US	2
Awka, NG	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

11 institutions · 86 of 86 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Micaria longipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

Forest8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 14.4–18.6

Seasonal swing summer↔winter23.1 °C

Max temp (day)23.9 °C 20.5–25.0

Min temp (night)10.7 °C 7.70–13.2

Precipitation18.6 mm/mo 12.5–54.8

Air humidity51.1 % 47.9–53.1

Moisture balance-97.3 mm/mo -165–-66.8

Vapour deficit972 Pa 812–1,071

Wind speed2.60 m/s 2.40–4.30

Cloud cover37.5 % 13.2–38.4

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)