Metcalfa pruinosa

(Say, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Flatidae/Metcalfa

At a glance

Occurrence records20 732

Data sources8

Biological traits0

DNA specimens2 022

eDNA detections2 036

Sources8 archives

Databases and archives Metcalfa pruinosa's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 036 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 022 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF20 732 records

Environmental DNA2 datasets · 12 countries2 036 detections

DNA & barcodingBOLD2 022 specimens

Genome at a glanceGoaT2n = 28

01Narrative

Metcalfa pruinosa, the citrus flatid planthopper, is a species of insect in the Flatidae family of planthoppers first described by Thomas Say in 1830.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 022 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metcalfa pruinosa has left across the world's sequence archives.

At a glance

DNA specimens2 022

BINs5

Marker genes2

eDNA detections2 036

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus1 964 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

244Tvariable

247Tvariable

310Amostly conserved

340Tvariable

439Cvariable

517Gvariable

541Amostly conserved

TCTGTATTTTATATTTGGAATTTGATCTGGACTAGTGGGAATAATAATAAGAATAATTATTCGAATAGAATTATCTCAACCAGGTTCAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.83%

Haplotypes35

BINs5

Most divergent pair20.5%

AsiaN.AmericaOtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Deocerus corniculatussame family12.2%Carthaeomorpha ballouisame family12.9%Metcracis metcalfisame family13.0%Metcracis humeralissame family13.0%Phantia zaitzevisame family13.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_070019 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT

The complete instruction manual Metcalfa pruinosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 271×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

2n 281×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type20 732 records

Wild obs. + sensor19 213

Museum / vouchered1 518

Other1

Range

Area of Occupancy AOO42 564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 9 004≤1 km 2 317≤10 km 1 143>10 km 1 698

14 162 georeferenced · 5 051 without coordinates

Open the mapobservation + sensor19 213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 21≤1 km 54≤10 km 182

257 georeferenced · 1 261 without coordinates

Open the institutions mapphysical evidence1 518

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NSMKlocation not on record	507
Champaign, US	254
University of Guelph, Centre for Biodiversity Genomicslocation not on record	131
College Station, US	121
University Park, US	104
Montgomery, US	78
University of Guelphlocation not on record	29
Cambridge, US	26
Wuzhou, CN	11
UDlocation not on record	10
North Carolina State University Insect Museumlocation not on record	9
University of Central Floridalocation not on record	7
DPIlocation not on record	6
Philadelphia, US	5
Radicondoli, IT	4
KNAMlocation not on record	3
Cornell University Insect Collectionlocation not on record	3
CUlocation not on record	2
St. Paul, US	2
University of Delawarelocation not on record	1
Tilburg, NL	1
Centre for Biodiversity Genomicslocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

23 institutions · 1 316 of 1 518 vouchered records shown · 202 without an institution code

09Environmental DNA2 036 detections

Where the DNA of Metcalfa pruinosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 036

Studies independent surveys2

Countries12

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 036 detections have coordinates

Open the map12 countries0

UrbanForest14. Artificial - Terrestrial|14.5 Urban Areas1. Forest & Woodland|1.4. Temperate ForestHaies de chenes liegesFloodplain forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 12.6–21.2

Seasonal swing summer↔winter24.4 °C

Max temp (day)23.6 °C 16.4–26.5

Min temp (night)14.4 °C 7.40–18.2

Precipitation77.5 mm/mo 51.0–112

Air humidity58.0 % 57.7–60.4

Moisture balance-62.1 mm/mo -82.4–21.7

Vapour deficit921 Pa 690–1,065

Wind speed2.50 m/s 2.00–3.90

Cloud cover40.1 % 36.0–43.1

CHELSA 1981–2010, ~9 km grid, at location & month of 1 423 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Metcalfa pruinosa

At a glance

Sources8 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type20 732 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 732 records