Metazygia zilloides

(Banks, 1898) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Metazygia

At a glance

Occurrence records426

Data sources9

Biological traits1

DNA specimens43

eDNA detections42

Sources9 archives

Databases and archives Metazygia zilloides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility426 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF426 records

Environmental DNA1 datasets · 2 countries42 detections

DNA & barcodingBOLD43 specimens

01Narrative

Metazygia zilloides is a species of orb weaver in the spider family Araneidae. It is found in the United States and a range from the Caribbean Sea to Honduras.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGenaro & Alayón 1994

Defence1

PredatorTrypoxylon subimpressum

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metazygia zilloides has left across the world's sequence archives.

At a glance

DNA specimens43

BINs2

Marker genes1

eDNA detections42

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

88Amostly conserved

94Tmostly conserved

100Cvariable

112Amostly conserved

374Amostly conserved

375Gmostly conserved

417Cmostly conserved

478Cmostly conserved

574Tmostly conserved

AACTTTATATTTAATTTTTGGTGCTTGAGCTGCCATAGTTGGAACTGCTATAAGAGTATTAATTCGGGTAGAATTAGGTCAACCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paraplectana tsushimensissame family12.5%Araneus eburneiventrissame family12.8%Mangora volcansame family13.7%Neoscona arabescasame family14.0%Neoscona oaxacensissame family14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type426 records

Wild obs. + sensor398

Museum / vouchered28

Origin

Native2

Range

Area of Occupancy AOO1 132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 229≤1 km 49≤10 km 7>10 km 40

325 georeferenced · 73 without coordinates

Open the mapobservation + sensor398

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	14
Denver, US	4
Cambridge, US	2
Tapachula, MX	2
Los Angeles, US	2
US	2
Ohio State University Acarology Laboratorylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

8 institutions · 28 of 28 vouchered records shown

09Environmental DNA42 detections

Where the DNA of Metazygia zilloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map2 countries0

on walls of buildings14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.7 °C 16.9–29.9

Seasonal swing summer↔winter12.1 °C

Max temp (day)31.0 °C 22.6–35.8

Min temp (night)24.6 °C 12.6–25.4

Precipitation91.0 mm/mo 50.4–115

Air humidity59.4 % 57.5–63.9

Moisture balance-57.0 mm/mo -127–-23.3

Vapour deficit1,395 Pa 803–1,776

Wind speed2.70 m/s 2.40–3.70

Cloud cover25.3 % 22.1–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)