Metastatia pyrrhorhoea

Hübner, 1827 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Metastatia

At a glance

Occurrence records47

Data sources6

Biological traits0

DNA specimens102

eDNA detections103

Sources6 archives

Databases and archives Metastatia pyrrhorhoea's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics102 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 3 countries103 detections

DNA & barcodingBOLD102 specimens

01Narrative

Metastatia pyrrhorhoea is a moth of the subfamily Arctiinae. It was described by Jacob Hübner in 1818. It is found in Guyana and Brazil (Pará), Costa Rica and Panama.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding102 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metastatia pyrrhorhoea has left across the world's sequence archives.

At a glance

DNA specimens102

BINs2

Marker genes1

eDNA detections103

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus97 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

67Gmostly conserved

202Gmostly conserved

289Gmostly conserved

433Gmostly conserved

628Amostly conserved

AACATTATACTTTATTTTTGGTATTTGAGCTGGAATAGTAGGGACTTCTTTAAGATTACTAATTCGGGCAGAATTAGGTAACCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes8

BINs2

Most divergent pair6.4%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eucereon consortasame family5.5%Delphyre flavicepssame family6.5%Episcepsis aureasame family6.7%Delphyre dizonasame family6.7%Bertholdia ockendenisame family6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type47 records

Wild obs. + sensor22

Museum / vouchered25

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 4≤1 km 7≤10 km 1>10 km 5

17 georeferenced · 5 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	11
Mississippi State, US	4
University of Pennsylvanialocation not on record	1
Research Collection of D. H. Janzen & W. Hallwachslocation not on record	1

4 institutions · 17 of 25 vouchered records shown · 8 without an institution code

09Environmental DNA103 detections

Where the DNA of Metastatia pyrrhorhoea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found103

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 103 detections have coordinates

Open the map3 countries0

1. Forest & Woodland | 1.6. Subtropical/Trop…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 23.1–25.7

Seasonal swing summer↔winter2.30 °C

Max temp (day)26.7 °C 25.5–28.2

Min temp (night)21.8 °C 20.7–23.8

Precipitation288 mm/mo 83.3–478

Air humidity73.2 % 68.4–75.5

Moisture balance179 mm/mo -44.1–344

Vapour deficit756 Pa 707–1,008

Wind speed1.60 m/s 1.10–2.30

Cloud cover31.3 % 15.1–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 101 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)