Metasesarma obesum

(Dana, 1851) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Sesarmidae/Metasesarma

At a glance

Occurrence records335

Data sources8

Biological traits1

DNA specimens39

eDNA detections37

Sources8 archives

Databases and archives Metasesarma obesum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility293 records↗

OBISOcean Biodiversity Information System42 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS335 records

Environmental DNA1 datasets · 1 countries37 detections

DNA & barcodingBOLD39 specimens

01Narrative

Metasesarma obesum, also known as the marble Batik crab, is a species of sesarmid crab.# It is a semiterrestrial and brackish-water crab that lives on sandy beaches.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metasesarma obesum has left across the world's sequence archives.

At a glance

DNA specimens39

BINs2

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P632 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

6Amostly conserved

51Cmostly conserved

361Cmostly conserved

414Tmostly conserved

471Gmostly conserved

483Cmostly conserved

486Cmostly conserved

546Cmostly conserved

601Cmostly conserved

632Amostly conserved

GGTACATCATTAAGATTAATTATTCGAGCAGAATTAAGACAACCAGGGAGCTTAATTGGTAATGATCAAATTTATAATGTAGTTGTAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes15

BINs2

Most divergent pair5.9%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sesarma reticulatumsame family7.2%Neosarmatium fourmanoirisame family7.9%Orisarma intermediumsame family8.3%Leptarma lenziisame family8.3%Sesarma curacaoensesame family8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type335 records

Wild obs. + sensor203

Museum / vouchered132

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 93≤1 km 27≤10 km 13>10 km 17

150 georeferenced · 53 without coordinates

Open the mapobservation + sensor203

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 2≤10 km 4>10 km 13

19 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	39
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	25
Sydney, AU	9
Los Angeles, US	6
Paris, FR	5
University of Floridalocation not on record	4
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1
RBINS-Scientific Heritagelocation not on record	1
Brussels, BE	1
Western Australian Museumlocation not on record	1

10 institutions · 92 of 132 vouchered records shown · 1 without an institution code

09Environmental DNA37 detections

Where the DNA of Metasesarma obesum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.6–24.6

Seasonal swing summer↔winter2.20 °C

Max temp (day)25.2 °C

Min temp (night)23.7 °C

Precipitation423 mm/mo

Air humidity71.8 %

Moisture balance255 mm/mo

Vapour deficit866 Pa

Wind speed3.60 m/s

Cloud cover37.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)