Metarranthis hypochraria

(Herrich-Schäffer) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records745

Data sources7

Biological traits0

DNA specimens5

eDNA detections2

Sources7 archives

Databases and archives Metarranthis hypochraria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility745 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF745 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD5 specimens

01Narrative

Metarranthis hypochraria, the common metarranthis moth, is a moth of the family Geometridae. It is found in eastern North America.Bug Guide The larvae feed on various trees and shrubs, but especially Prunus species. They are stick mimics. The larvae can be found from June to July in one generation per year.NPWRC :: Caterpillars of Eastern Forests

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis hypochraria has left across the world's sequence archives.

At a glance

DNA specimens5

BINs3

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

22Gvariable

31Avariable

40Avariable

160Gvariable

178Tvariable

208Avariable

211Avariable

212Cmostly conserved

214Avariable

220Cmostly conserved

229Amostly conserved

235Tvariable

268Avariable

286Amostly conserved

340Tvariable

364Tvariable

367Tvariable

397Cvariable

400Tvariable

409Avariable

412Gmostly conserved

421Cvariable

433Amostly conserved

451Cmostly conserved

481Gvariable

506Gmostly conserved

511Avariable

520Avariable

547Cvariable

548Cvariable

571Cvariable

622Avariable

646Tvariable

AACATTATATTTCATTTTTGGGATTTGAGCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes3

BINs3

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis hypochariasame genus2.4%Metarranthis lateritiariasame genus3.0%Metarranthis homurariasame genus3.0%Metarranthis pilosariasame genus3.5%Metarranthis apiciariasame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type745 records

Wild obs. + sensor390

Museum / vouchered355

Range

Area of Occupancy AOO1 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 197≤1 km 64≤10 km 20>10 km 19

300 georeferenced · 90 without coordinates

Open the mapobservation + sensor390

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 17≤1 km 51≤10 km 102>10 km 21

191 georeferenced · 164 without coordinates

Open the institutions mapphysical evidence355

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	105
Cleveland Museum of Natural History, OH (CLEV)location not on record	59
Colorado State Universitylocation not on record	41
East Lansing, US	21
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
Washington, US	13
St. Paul, US	10
Philadelphia, US	9
Mississippi State, US	8
OSUClocation not on record	5
Cornell University Insect Collectionlocation not on record	5
UDlocation not on record	5
Royal Saskatchewan Museumlocation not on record	5
ASUlocation not on record	4
Cambridge, US	2
Decorah, US	2
Blacksburg, US	2
CUlocation not on record	1
Georgia Museum of Natural Historylocation not on record	1
Toronto, CA	1

20 institutions · 318 of 355 vouchered records shown · 37 without an institution code

09Environmental DNA2 detections

Where the DNA of Metarranthis hypochraria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 19.7–23.6

Seasonal swing summer↔winter25.5 °C

Max temp (day)26.7 °C 24.9–28.5

Min temp (night)16.7 °C 14.7–18.7

Precipitation122 mm/mo 104–140

Air humidity55.9 % 55.7–56.1

Moisture balance-46.2 mm/mo -70.2–-22.1

Vapour deficit1,151 Pa 1,022–1,280

Wind speed3.80 m/s 3.50–4.00

Cloud cover37.1 % 35.3–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)