Metarhizium majus

(J.R.Johnst.) J.F.Bisch., S.A.Rehner & Humber · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Clavicipitaceae/Metarhizium

At a glance

Occurrence records20

Data sources6

Biological traits0

DNA specimens0

eDNA detections20

Sources6 archives

Databases and archives Metarhizium majus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF20 records

Environmental DNA2 datasets · 15 countries20 detections

DNA & barcodingNCBIsequences

Genome at a glanceNCBI≈42 Mbp

01Narrative

Metarhizium majus is the name given to a group of fungal isolates that are known to be virulent against Scarabaeidae, a family of beetles. Previously, this species has had variety status in Metarhizium anisopliae (var. majus) and its name is derived from characteristically very large spores (typically 2.5–4 µm x 10–14 µm long) for the genus Metarhizium. There has been considerable interest in developing isolates of this species into mycoinsecticides: especially for coconut and oil palm beetle pests in SE Asia, the Pacific region and Africa. Metarhizium majus.jpg|''Metarhizium majus'' infected ''[[Oryctes rhinoceros]]'' larva with hyphal (whitish colour) and conidia sporulation/geminating (greenish colour) from its cuticle. M. majus infection stages on Oryctes rhinoceros grubs in field condition.jpg|Stages of ''[[Oryctes rhinoceros]]'' larva infected with ''M. majus''. From left to right, 1st column: Infection symptom with "black dotes" or necrotic spots on integument; 2nd: Mummified; Mycelium (whitish colour) grow on integument; 3rd: Conidia (greenish colour) grow on integument; 4th: Decomposed grubs. It is an anamorph, its telomorphic form is Cordyceps brittlebankisoides.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarhizium majus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections20

Countries15

The DNA barcodea real sequence read deposited for this species

ITSMW080714.1 ↗520 bpMalaysia

ACGT

GAACAGCGGAGGGATCATTACCGAGTTATCCAACTCCCAACCCCTGTGAATCATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCG …

Metarhizium majus isolate 6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Metarhizium majus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈42 062 993 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Metarhizium majus0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type20 records

Museum / vouchered20

Range

Area of Occupancy AOO80 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence20

10Collections & institutions

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	1

1 institutions · 1 of 20 vouchered records shown · 19 without an institution code

09Environmental DNA20 detections

Where the DNA of Metarhizium majus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries15

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map15 countries0

NeotropicAfrotropicAustralasiaNearcticIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 16.9–25.6

Seasonal swing summer↔winter5.40 °C

Max temp (day)25.6 °C 21.4–28.4

Min temp (night)18.7 °C 11.7–23.1

Precipitation145 mm/mo 93.6–269

Air humidity64.6 % 56.8–68.6

Moisture balance26.7 mm/mo -39.4–144

Vapour deficit983 Pa 682–1,057

Wind speed2.20 m/s 1.10–4.40

Cloud cover34.1 % 24.5–52.2

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)