Metarhizium flavoviride

W.Gams & Rozsypal · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Clavicipitaceae/Metarhizium

At a glance

Occurrence records135

Data sources10

Biological traits0

DNA specimens13

eDNA detections186

Sources10 archives

Databases and archives Metarhizium flavoviride's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI186 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF135 records

Environmental DNA8 datasets · 15 countries186 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceGoaT · NCBI≈40 Mbp

01Narrative

Metarhizium flavoviride is the name given to a group of fungal isolates that are known to be virulent against Hemiptera and some Coleoptera. Spores (conidia) are light grey-green and oval-shaped (approximately 7-11 µm long).Humber RA. 1997. Fungi: identification. In: Manual of techniques in insect pathology. San Diego, California (USA): Academic Press Inc. p 153-185. As with other Metarhizium species, there has been interest in developing isolates into mycoinsecticides: with work carried out on rice insect pests during the 1970-80s.Shepard BM, Barrion AT, Litsinger JA. 1987. Helpful insects, spiders, and pathogens. Manila (Philippines): International Rice Research Institute. 127 pp. However, such isolates appear to be more difficult to mass-produce, so there has been less commercial activity than with other Metarhizium species. In light of new molecular techniques, we now know that references to this species for control of locusts (e.g. in early LUBILOSA Programme literature) should apply to Metarhizium acridum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition14 compounds

Compounds documented for Metarhizium flavoviride across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Chromones6

Triketide meroterpenoids3

4-pyrone derivatives $ Triketide meroterpenoids2

Naphthalenes and derivatives1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(5-Hydroxy-10-methoxy-4-oxo-2-propylbenzo[h]chromen-8-yl) hydrogen sulfate	present	NPASS
(5-Hydroxy-6,10-dimethoxy-4-oxo-2-propylbenzo[h]chromen-8-yl) hydrogen sulfate	present	NPASS
5,10-Dihydroxy-8-methoxy-2-propylbenzo[h]chromen-4-one	present	NPASS
5,8-Dihydroxy-6,10-Dimethoxy-2-Methylbenzo[H]Chromen-4-One	present	NPASS
Metarhizin A	present	LOTUS
Metarhizin B	present	LOTUS
Metarhizin C	present	LOTUS
Viridoxin A	present	LOTUS
Viridoxin B	present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarhizium flavoviride has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes1

GenBank sequences10

eDNA detections186

Countries15

The DNA barcodea real sequence read deposited for this species

ITSPV771389.1 ↗302 bpSpain · 2020

ACGT

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCG …

Metarhizium flavoviride clone Fungi-200 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Metarhizium flavoviride carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈39 785 483 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Metarhizium flavoviride0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~49.8 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin49.8 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type135 records

Museum / vouchered134

Cultivated / captive1

Range

Area of Occupancy AOO236 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 21

21 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence134

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

10Collections & institutions

Institution	Specimens
Centro Nacional de Referencia de Control Biológicolocation not on record	18
DPIlocation not on record	12
Bernard Price Institute for Palaeontological Researchlocation not on record	1
WU-MYClocation not on record	1

4 institutions · 32 of 134 vouchered records shown · 100 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA186 detections

Where the DNA of Metarhizium flavoviride was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found186

Studies independent surveys8

Countries15

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 186 detections have coordinates

Open the map15 countries0

IndomalayanAustralasiaPalearcticNeotropicNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature15.0 °C 7.00–25.0

pH5.90 4.80–6.70

Conductivity117 µS/cm 28.0–247

Organic carbon3.73 % 1.11–5.69

Nitrate-N11.0 mg/kg 2.00–71.0

Phosphorus62.5 mg/kg 12.0–239

Clay21.2 % 10.9–33.3

Sand67.8 % 49.8–83.6

Depth0 m 0–0.2

SoilKandosolSodosolFerrosolLatLon out of rangeVertosolKurosol

53 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 12.2–18.2

Seasonal swing summer↔winter8.50 °C

Max temp (day)16.6 °C 14.5–22.2

Min temp (night)8.60 °C 8.40–16.2

Precipitation55.7 mm/mo 55.7–127

Air humidity57.4 % 56.7–63.4

Moisture balance-67.3 mm/mo -67.3–92.1

Vapour deficit622 Pa 533–858

Wind speed4.00 m/s 2.90–5.60

Cloud cover40.0 % 22.5–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 168 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)