Metaponpneumata rogenhoferi

Möschler, 1890 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Metaponpneumata

At a glance

Occurrence records1 552

Data sources7

Biological traits0

DNA specimens329

eDNA detections350

Sources7 archives

Databases and archives Metaponpneumata rogenhoferi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 552 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI350 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics329 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 552 records

Environmental DNA1 datasets · 3 countries350 detections

DNA & barcodingBOLD329 specimens

01Narrative

Metaponpneumata is a monotypic moth genus of the family Noctuidae. Its only species, Metaponpneumata rogenhoferi, is found in Mexico and Puerto Rico. Both the genus and species were first described by Heinrich Benno Möschler in 1890.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding329 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metaponpneumata rogenhoferi has left across the world's sequence archives.

At a glance

DNA specimens329

BINs1

Marker genes1

eDNA detections350

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus326 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

166Amostly conserved

571Tmostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACTCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 79 variants.

Diversity (π)0.20%

Haplotypes79

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hecatera weissisame family5.9%Hecatera maderaesame family6.0%Eremohadena immundasame family6.0%Cydosia curvinellasame family6.1%Simyra dentinosasame family6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 552 records

Wild obs. + sensor1 103

Museum / vouchered449

Range

Area of Occupancy AOO1 752 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 613≤1 km 150≤10 km 17>10 km 97

877 georeferenced · 226 without coordinates

Open the mapobservation + sensor1 103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 5≤1 km 7≤10 km 121>10 km 4

137 georeferenced · 312 without coordinates

Open the institutions mapphysical evidence449

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	206
ASUlocation not on record	105
Mississippi State, US	37
Albuquerque, US	21
Cornell University Insect Collectionlocation not on record	20
San Diego, US	8
University of California, Davislocation not on record	6
East Lansing, US	5
Ciudad de México, MX	4
US	4
New Haven, US	3
University of Pennsylvanialocation not on record	1
Denver, US	1
Centre for Biodiversity Genomicslocation not on record	1

14 institutions · 422 of 449 vouchered records shown · 27 without an institution code

09Environmental DNA350 detections

Where the DNA of Metaponpneumata rogenhoferi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found350

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 350 detections have coordinates

Open the map3 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 25.2–30.4

Seasonal swing summer↔winter18.9 °C

Max temp (day)31.2 °C 27.1–36.7

Min temp (night)23.2 °C 20.0–24.3

Precipitation63.1 mm/mo 21.2–345

Air humidity52.8 % 45.7–71.3

Moisture balance-142 mm/mo -168–199

Vapour deficit1,624 Pa 915–2,362

Wind speed4.20 m/s 2.30–4.50

Cloud cover23.7 % 15.9–42.8

CHELSA 1981–2010, ~9 km grid, at location & month of 334 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Metaponpneumata rogenhoferi

At a glance

Sources7 archives

At a glance

Record type1 552 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 552 records