Mesoleuca ruficillata

(Guenée, 1858) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Mesoleuca

At a glance

Occurrence records2 088

Data sources6

Biological traits0

DNA specimens81

eDNA detections78

Sources6 archives

Databases and archives Mesoleuca ruficillata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 088 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI78 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 088 records

Environmental DNA1 datasets · 2 countries78 detections

DNA & barcodingBOLD81 specimens

01Narrative

Mesoleuca ruficillata, the white-ribboned carpet moth, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Mesoleuca ruficillata is 7307.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mesoleuca ruficillata has left across the world's sequence archives.

At a glance

DNA specimens81

BINs1

Marker genes1

eDNA detections78

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus70 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

226Cmostly conserved

241Amostly conserved

263Cmostly conserved

433Avariable

619Tvariable

625Avariable

AACTCTTTATTTTATTTTTGGTATTTGATCTGGTATAATTGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes10

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mesoleuca albicillatasame genus6.1%Entephria lagganatasame family8.5%Entephria takuatasame family8.8%Gandaritis fixsenisame family9.0%Entephria caesiatasame family9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 088 records

Wild obs. + sensor1 773

Museum / vouchered315

Range

Area of Occupancy AOO4 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 001≤1 km 271≤10 km 74>10 km 125

1 471 georeferenced · 302 without coordinates

Open the mapobservation + sensor1 773

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 27≤1 km 18≤10 km 74>10 km 4

123 georeferenced · 192 without coordinates

Open the institutions mapphysical evidence315

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	53
University of Alberta Museums (UAM)location not on record	37
University of Guelph, Centre for Biodiversity Genomicslocation not on record	33
Colorado State Universitylocation not on record	23
Cleveland Museum of Natural History, OH (CLEV)location not on record	19
Royal Saskatchewan Museumlocation not on record	17
Denver, US	11
East Lansing, US	8
Philadelphia, US	7
Cambridge, US	6
Vernal, US	5
ASUlocation not on record	5
Centre for Biodiversity Genomicslocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Toronto, CA	3
UDlocation not on record	3
OSUClocation not on record	3
St. Paul, US	3
Saint John, CA	2
Edmonton, CA	2
University Park, US	1
Blacksburg, US	1
Tartu, EE	1
University of Guelphlocation not on record	1
SOVTlocation not on record	1

25 institutions · 253 of 315 vouchered records shown · 62 without an institution code

09Environmental DNA78 detections

Where the DNA of Mesoleuca ruficillata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found78

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 78 detections have coordinates

Open the map2 countries0

ForestBeach5. Wetlands (inland)1. Forest & Woodland|1.1. Boreal Forest1. Forest & WoodlandTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 6.70–19.0

Seasonal swing summer↔winter26.1 °C

Max temp (day)19.7 °C 12.1–23.6

Min temp (night)10.0 °C 1.00–15.4

Precipitation94.9 mm/mo 52.7–148

Air humidity58.5 % 53.4–62.7

Moisture balance-26.3 mm/mo -68.7–29.7

Vapour deficit716 Pa 414–875

Wind speed2.90 m/s 1.40–7.40

Cloud cover39.2 % 33.2–51.3

CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mesoleuca ruficillata

At a glance

Sources6 archives

At a glance

Record type2 088 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 088 records