Mesoleuca gratulata

(Walker, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Mesoleuca

At a glance

Occurrence records1 524

Data sources8

Biological traits0

DNA specimens19

eDNA detections18

Sources8 archives

Databases and archives Mesoleuca gratulata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 524 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 524 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD19 specimens

01Narrative

Mesoleuca gratulata, known generally as the western white-ribboned carpet or half-white carpet moth, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Mesoleuca gratulata is 7308.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mesoleuca gratulata has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes2

BINs2

Most divergent pair4.3%

Where individuals differ — all 29 variable positions, in barcode order

31Tmostly conserved

40Cmostly conserved

109Gmostly conserved

127Cmostly conserved

181Gmostly conserved

184Amostly conserved

190Gmostly conserved

193Tmostly conserved

197Cmostly conserved

220Amostly conserved

268Gmostly conserved

274Amostly conserved

280Cmostly conserved

316Amostly conserved

355Cmostly conserved

364Tmostly conserved

367Cmostly conserved

499Tmostly conserved

514Amostly conserved

517Amostly conserved

539Cmostly conserved

541Tmostly conserved

542Cmostly conserved

548Cmostly conserved

568Gmostly conserved

577Gmostly conserved

601Cmostly conserved

625Gmostly conserved

646Cmostly conserved

AACACTATACTTTATTTTTGGAATTTGAGCTGGAATAGTCGGAACTTCACTAAGTTTATTAATCCGAGCAGAATTAGGAAACCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Rheumaptera inanatasame family10.2%Lampropteryx otregiatasame family10.6%Epigynopteryx townsendisame family10.6%Schinia illustrasame order10.9%Schinia hulstiasame order10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 524 records

Wild obs. + sensor1 409

Museum / vouchered115

Range

Area of Occupancy AOO4 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 705≤1 km 257≤10 km 91>10 km 71

1 124 georeferenced · 285 without coordinates

Open the mapobservation + sensor1 409

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 3≤1 km 14≤10 km 49>10 km 15

81 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence115

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	39
Colorado State Universitylocation not on record	13
Vernal, US	11
Philadelphia, US	8
University of Alberta Museums (UAM)location not on record	7
Essig Museum of Entomologylocation not on record	6
Natural History Museum of Utahlocation not on record	5
Santa Cruz, US	3
St. Paul, US	3
Tartu, EE	2
Edmonton, CA	2
East Lansing, US	2
Cambridge, US	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
National Institute of Biological Resourceslocation not on record	1
SOVTlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

17 institutions · 106 of 115 vouchered records shown · 9 without an institution code

09Environmental DNA18 detections

Where the DNA of Mesoleuca gratulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.40 °C 8.50–9.70

Seasonal swing summer↔winter13.0 °C

Max temp (day)11.8 °C 11.8–13.6

Min temp (night)5.70 °C 4.00–7.50

Precipitation140 mm/mo 67.6–243

Air humidity61.7 % 59.0–64.0

Moisture balance167 mm/mo

Vapour deficit469 Pa 398–504

Wind speed5.20 m/s

Cloud cover46.1 % 42.0–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mesoleuca gratulata

At a glance

Sources8 archives

At a glance

Record type1 524 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 524 records