Merodon armipes

Rondani, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Merodon

At a glance

Occurrence records54

Data sources6

Biological traits0

DNA specimens37

eDNA detections5

Sources6 archives

Databases and archives Merodon armipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF54 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD37 specimens

01Narrative

Merodon armipes is een vliegensoort uit de familie van de zweefvliegen (Syrphidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1843 door Rondani.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Merodon armipes has left across the world's sequence archives.

At a glance

DNA specimens37

BINs2

Marker genes4

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P607 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.46%

Haplotypes2

BINs2

Most divergent pair2.5%

Where individuals differ — all 15 variable positions, in barcode order

64Cmostly conserved

127Cmostly conserved

146Cmostly conserved

289Tmostly conserved

295Cmostly conserved

356Cmostly conserved

377Tmostly conserved

439Cmostly conserved

493Amostly conserved

511Tmostly conserved

535Tmostly conserved

544Tmostly conserved

553Tmostly conserved

556Amostly conserved

589Cmostly conserved

AAGAATTTTAATTCGAATTGAATTAGGTCATCCAGGATCATTTATTGGTGATGATCAAATTTACAATGTTATTGTAACAGCTCATGCCTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Merodon ruficornissame genus3.0%Merodon analissame genus5.3%Merodon constanssame genus5.3%Merodon rufussame genus5.6%Merodon caucasicussame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type54 records

Wild obs. + sensor47

Museum / vouchered4

Cultivated / captive3

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 7≤1 km 2≤10 km 32>10 km 1

42 georeferenced · 5 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Merodon armipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 12.1–14.7

Seasonal swing summer↔winter20.4 °C

Max temp (day)17.9 °C 16.6–19.1

Min temp (night)7.50 °C 6.70–8.30

Precipitation64.2 mm/mo 56.5–72.0

Air humidity57.5 % 56.5–58.5

Moisture balance-48.6 mm/mo -63.2–-34.0

Vapour deficit706 Pa 670–742

Wind speed3.10 m/s

Cloud cover36.9 % 32.0–41.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)