Meristotheca papulosa

(Montagne) J.Agardh · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gigartinales/Solieriaceae/Meristotheca

At a glance

Occurrence records923

Data sources8

Biological traits0

DNA specimens14

eDNA detections11

Sources8 archives

Databases and archives Meristotheca papulosa's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility528 records↗

OBISOcean Biodiversity Information System395 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS923 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Meristotheca papulosa (synonyms: M. japonica and Eucheuma papulosa) is a red alga, popular as a sea vegetable in Taiwan, where it is known as jiguancai (, literally "cockscomb vegetable"), and in Japan, where it is known as tosaka-nori (), which can be prefixed with aka (red) so as to distinguish it from the ao (green) and shiro (white) varieties.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Meristotheca papulosa has left across the world's sequence archives.

At a glance

DNA specimens14

BINs4

Marker genes2

GenBank sequences10

eDNA detections11

The DNA barcodea real sequence read deposited for this species

rbcLAB195318.1 ↗1 266 bpJapan

ACGT

CTGCAGCTGTTGCAGGAGAATCATCTACAGCTACTTGGACAGTAGTTTGGACGGATCTTTTAACTGCCTGTGATCTATATAGAGCAAAAG …

Meristotheca papulosa chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, strain: M91

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

AsiaAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Meristotheca halymenioidessame genus7.6%Agardhiella subulatasame family8.2%Solieria chordalissame family8.6%Meristotheca odontolomasame genus8.9%Meristotheca procumbenssame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL10

animal barcodeplant barcode

08Occurrence & distribution

Record type923 records

Wild obs. + sensor370

Museum / vouchered521

Other32

Origin

Native18

Range

Area of Occupancy AOO852 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 9.9 m · max 17.7 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 146

150 georeferenced · 220 without coordinates

Open the mapobservation + sensor370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 1≤1 km 28≤10 km 35>10 km 17

81 georeferenced · 440 without coordinates

Open the institutions mapphysical evidence521

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	167
Ann Arbor, US	29
Chapel Hill, US	18
Mount Annan, AU	18
Kensington, AU	15
MeiseBGlocation not on record	9
GENTlocation not on record	9
South Kensington, GB	9
Cincinnati, US	7
James Cook Townsvillelocation not on record	6
Bronx, US	5
National Institute of Biological Resourceslocation not on record	5
LDlocation not on record	5
Museo Entomologico de Leonlocation not on record	4
Acadia Universitylocation not on record	2
Vancouver, CA	1
Cape Town, ZA	1
Department of Microbiology, Faculty of Sciencelocation not on record	1
Burlington, US	1
Honolulu, US	1
University of Stellenboschlocation not on record	1
Adelaide, AU	1

22 institutions · 315 of 521 vouchered records shown · 23 without an institution code

09Environmental DNA11 detections

Where the DNA of Meristotheca papulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 7.40–7.40

Seasonal swing summer↔winter25.4 °C

Max temp (day)9.60 °C

Min temp (night)3.00 °C

Precipitation344 mm/mo

Air humidity64.9 %

Moisture balance263 mm/mo

Vapour deficit428 Pa

Wind speed2.90 m/s

Cloud cover44.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)