Meripilus sumstinei

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Meripilaceae/Meripilus

At a glance

Occurrence records6 654

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Meripilus sumstinei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 654 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 654 records

DNA & barcodingNCBIsequences

01Narrative

Meripilus sumstinei, commonly known as the giant polypore or the black-staining polypore, is a species of fungus in the family Meripilaceae. Originally described in 1905 by William Alphonso Murrill as Grifola sumstinei, it was transferred to Meripilus in 1988. It is found in North America, where it grows in large clumps on the ground around the base of oak trees and tree stumps. The mushroom is edible.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Meripilus sumstinei has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP156199.1 ↗632 bpUSA · 2023

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTCCAAACTTGGGTGAGGTTGTTGCTGGCCCCTTGGGGTAT …

Meripilus sumstinei isolate OMDL iNat # 176547297 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS5

fungal barcode

08Occurrence & distribution

Record type6 654 records

Wild obs. + sensor6 620

Museum / vouchered34

Range

Area of Occupancy AOO17 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 3 906≤1 km 692≤10 km 498>10 km 608

5 704 georeferenced · 916 without coordinates

Open the mapobservation + sensor6 620

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 4≤1 km 2≤10 km 9>10 km 3

18 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis and Elkins Collegelocation not on record	15
Chicago, US	6
TENN-Flocation not on record	3
Mexico City, MX	2
Karlsruhe, DE	2
Chapel Hill, US	1
Ann Arbor, US	1
CA	1
Université de Montréal Biodiversity Centrelocation not on record	1
Colorado State Universitylocation not on record	1

10 institutions · 33 of 34 vouchered records shown · 1 without an institution code

At a glance

Sources6 archives

At a glance

Record type6 654 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 10 geolocated

Record type6 654 records