Mentha cunninghamii

(Benth.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Mentha

At a glance

Occurrence records376

Data sources7

Biological traits22

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Mentha cunninghamii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility376 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources22 traits

Occurrence & distributionGBIF376 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 72

01Narrative

Mentha cunninghamii, known commonly as New Zealand mint or Māori mint, is a species within the Mentha (mint) genus, endemic to four islands in New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology6

Fruit length1 mm

Leaf length max10 mm

Leaf width10 mm

Leaf width max10 mm

Leaf width min10 mm

Plant height max0.1 m

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeunspecialized

Life formperennial

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mentha cunninghamii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKT626740.1 ↗1 157 bpNew Zealand · 1994

ACGT

AAGTGTTGGGTTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGC …

Mentha cunninghamii voucher CHR:508454 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Mentha cunninghamii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome records72–722n range72median72mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 722×CCDB · new-zealand · CCDB · ipcn-api-dl

CCDB · new-zealand

CCDB · ipcn-api-dl — Chambers, H. L. & K. E. Hummer. 1994. Chromosome counts in the Mentha collection at the USDA-ARS National Clonal Germplasm Repository. Taxon 43: 423–432.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type376 records

Wild obs. + sensor167

Museum / vouchered208

Other1

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 46≤1 km 18≤10 km 56>10 km 11

131 georeferenced · 36 without coordinates

Open the mapobservation + sensor167

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 6≤1 km 1≤10 km 8>10 km 4

19 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	71
Christchurch, NZ	70
Wellington, NZ	59
Rotorua, NZ	3
Hobart, AU	2
Museo Entomologico de Leonlocation not on record	1
Chicago, US	1
LDlocation not on record	1

8 institutions · 208 of 208 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)