Mentha arvensis
speciesAt a glance
Occurrence records195 151
Data sources17
Biological traits129
DNA specimens61
eDNA detections34
Sources17 archives
Databases and archives Mentha arvensis's data was compiled from.
WikipediaWikimedia Foundation18 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility195 151 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics61 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources129 traits
Chemical compositionFooDB · LOTUS · NPASS6 023 compounds
Occurrence & distributionGBIF195 151 records
Environmental DNA1 datasets · 9 countries34 detections
DNA & barcodingBOLD · NCBI61 specimens
Genome at a glanceCCDB · GoaT1.3 Gbp
01Narrative
Mentha arvensis, the corn mint, field mint, or wild mint, is a species of flowering plant in the mint family Lamiaceae. It has a circumboreal distribution, being native to the temperate regions of Europe and western and central Asia, east to the Himalaya and eastern Siberia, and North America.Euro+Med Plantbase Project: Mentha arvensis Mentha canadensis, the related species, is also included in Mentha arvensis by some authors as two varieties, M. arvensis var. glabrata Fernald (North American plants such as American Wild Mint) and M. arvensis var. piperascens Malinv. ex L. H. Bailey (eastern Asian plants such as Japanese mint).Quattrocchi, Umberto (1947), CRC World dictionary of plant names: Common names, Scientific Names, Eponyms, Synyonyms, and Etymology, III M-Q, CRC Press, p. 1659
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology18
Fruit length1 mm
Leaf length max40 mm
Leaf mass16.85 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 510 mm² · GIFT: 604 mm²
Leaf width16 mm
Leaf width max16 mm
Leaf width min16 mm
Plant height0.52 m
⚠ sources differ — GIFT: 0.52 m · LEDA: 0.3 m · USDA: 0.792 m · TRY: 0.384 m
Plant height generative0.337 m
Plant height max1 m
Plant height min0.15 m
Seed length0.95 mm
Seed mass0.136 mg
⚠ sources differ — TRY: 0.136 mg · LEDA: 0.162 mg · GIFT: 0.17 mg
Seed mass max0.36 mg
Seed mass min0.06 mg
Seed volume0.18 mm³
Seed volume max0.18 mm³
Seed volume min0.18 mm³
Life cycle & reproduction36
After harvest regrowth rateSlow
Bloom periodSpring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewater
Flower colourwhite
Flower conspicuousYes
Flowering endOct
Flowering startJun
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryShort
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number200
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment28
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation mean1 800 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Growth formherb
Growth form USDASingle Stem
Habitat GIFTcanals, crop fields, forest, lakes, meadows, old fields, rivers, shores, swamps
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min100 days
Leaf C:N ratio26.45 g/g
Leaf c426 mg/g
Leaf dry-matter content (LDMC)186 mg/g
⚠ sources differ — TRY: 186 mg/g · LEDA: 173 mg/g
Leaf n16.3 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min20 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)36.78 mm²/mg
⚠ sources differ — TRY: 36.78 mm²/mg · LEDA: 36.74 mm²/mg · GIFT: 41.83 mm²/mg
Temperature min-33 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max19 360 per acre
Planting density min3 450 per acre
03Chemical composition6 023 compounds
Compounds documented for Mentha arvensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices🌿 Tea
Compound class profile5 classes
Menthane monoterpenoids $ Monocyclic monoterpenoids82
Aminoacids67
Glycerophospholipids57
Cinnamic acids and derivatives41
Flavones38
Documented compounds6 023 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Potassium | 3,510 mg/100g | FooDB | |
| Rosmarinic acid | 2,800 mg/100g | FooDB | |
| 17alpha-ethynylestradiol | 2,105 mg/100g | FooDB | |
| alpha-Carvone | 1,705 mg/100g | FooDB | |
| (-)-Menthol | 1,494.4 mg/100g | FooDB | |
| Calcium | 1,350 mg/100g | FooDB | |
| (-)-Menthone | 1,296.5 mg/100g | FooDB | |
| (R)-p-Menth-4(8)-en-3-one | 1,253 mg/100g | FooDB | |
| (±)-Menthone | 1,203.55 mg/100g | FooDB |
05DNA & barcoding61 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mentha arvensis has left across the world's sequence archives.
At a glance
DNA specimens61
Marker genes9
GenBank sequences10
eDNA detections34
Countries11
The DNA barcodea real sequence read deposited for this species
GTCGCCCCCCATCCCCGCGCACACAGCCGGGCGGTTGGGGGCGGAGATTGGCCTCCCGTGCGCCTCGGTGCGCGGCCGGCCCAAATGCGA …
Mentha arvensis voucher 63782 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★trnL-F★ITS6★ITS1★ITS2atpF-atpHtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Mentha arvensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 310 520 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Mentha arvensis1.31 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 72 n = 36
Ploidypolyploid inferred
Chromosome records36–1202n range72median72mode53records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 7227×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · brit-fl — Morton, J.K. Watsonia 3: 244-252 (1956)
CCDB · brit-fl — Harley, R.M., Brighton, C.A. Bot. J. Linn. Soc. 74: 71-96 (1977)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3517
CCDB · fl-europaea — Olsson, 1967
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · book-ipcn65 — Baquar & R. 1965
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Pervichnyj citogeneticheskij monitoring flory Belorussii. Izv. Akad. Nauk Azerbajdzansk. SSR, Ser. Biol. Nauk 6: 8–11.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Skalinska, M., E. Pogan, R. CZAPIK & e. al. 1978. Further studies in chromosome numbers of Polish angiosperms. XII. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Harley, R. M. & C. A. BRIGHTON. 1977. Chromosome numbers in the genus Mentha L. Bot. J. Linn. Soc. 74: 71–96.
CCDB · ipcn-api-dl — Murin, A. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Chambers, H. L. & K. E. Hummer. 1994. Chromosome counts in the Mentha collection at the USDA-ARS National Clonal Germplasm Repository. Taxon 43: 423–432.
CCDB · book-ipcn67-71 — OLSSON, U. 1967. Chemotaxonomic analysis of some cytotypes in the Mentha x verticillata complex (Labiatae). Bot.~120: 255-267.
CCDB · book-indian_vol1 — Schurhoff, P.N. 1929 ; Lietz, I. 1930 ; Rohweder, H. 1937; Morton, J.K. 1956a ; Olsson, U. 1967
CCDB · book-atlas-flowering-plants — Ruttle 193la
CCDB · Cave1956 — Morton b
CCDB · CromoCat 2015 — Harley, R. M. & Brighton, C. A. (1977). Chromosome numbers in the genus Mentha L. Bot. J. Linn. Soc. 74: 71-96.
CCDB · CromoCat 2015 — Tyagi, B. R. & A. A. Naqvi (1987). Relevance of chromosome number variation to yield and quality of essential oil in Mentha arvensis L. Cytologia 52: 377–385
CCDB · CromoCat 2015 — Chambers, H. L. & Hummer, K. E. (1994). Chromosome counts in the Mentha collection at the USDA-ARS National Clonal Germoplasm Repository Taxon 43(3): 423-432.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
2n 366×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · poland — Pogan E., Jankun A., Ma?ecka J., Wcis?o H. et al. 1986. Further studies in chromosome numbers of Polish Angiosperms. Part XIX. Acta Biol. Cracov. Ser. Bot. 28, 65-85.
CCDB · ipcn-api-dl — Vembu, B. & R. Sampathkumar. 1982. Karyomorphological studies in some members of Lamiaceae. J. Cytol. Genet. 17: 97–106.
CCDB · ipcn-api-dl — Ayyangar, K. R. & B. Vembu. 1985. Karyo-specific and karyo-generic affiliations amongst Mentha arvensis Benth., M. piperita Linn. and Origanum vulgare Linn. Proc. Indian Sci. Congr. Assoc. 72(3–VI): 127.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun, J. Maslecka & H. Wcisslo. 1986. Further studies in chromosome numbers of Polish angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65–85.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · CromoCat 2015 — Pogan, E., A. Jankun, J. Malecka & H. Wcislo. (1986). Further studies in chromosome numbers of Polish Angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65-85.
2n 546×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-fedorov +1
CCDB · book-ipcn65 — Sobti 1965
CCDB · ipcn-api-dl — Gill, L. S. 1981. Chromosomal evolution and incidence of polyploidy in the Canadian Labiatae. Rev. Cytol. Biol. Vég., Bot. 4: 331–339.
CCDB · ipcn-api-dl — Tucker, A. O., R. M. Harley & D. E. Fairbrothers. 1980. The Linnaean types of Mentha (Lamiaceae). Taxon 29: 233–255.
CCDB · ipcn-api-dl — Gill, L. S. 1981. Biosystematics of the tribe Satureineae (Labiatae) in Canada II. Cytologia 46: 27–44.
CCDB · book-fedorov — Sobti 1965
CCDB · book-atlas-flowering-plants — Wolf 1929
2n 903×CCDB · book-indian_vol1 · CCDB · Cave1959 · CCDB · CromoCat 2015
CCDB · book-indian_vol1 — Sharma, A.K. & Bhattacharyya, N.K. (Fedorov)
CCDB · Cave1959 — Sharma & Bhat. 1959b
CCDB · CromoCat 2015 — Tyagi, B. R. & A. A. Naqvi (1987). Relevance of chromosome number variation to yield and quality of essential oil in Mentha arvensis L. Cytologia 52: 377–385
2n 962×CCDB · book-ipcn65 · CCDB · Cave1963
CCDB · book-ipcn65 — Sobti 1965
CCDB · Cave1963 — Lutkov 1962
2n 421×CCDB · fl-europaea
CCDB · fl-europaea — Morton, 1956
2n 601×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pogan, E., A. Jankun, J. Maslecka & H. Wcisslo. 1986. Further studies in chromosome numbers of Polish angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65–85.
2n 641×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tyagi, B. R. & A. A. Naqvi (1987). Relevance of chromosome number variation to yield and quality of essential oil in Mentha arvensis L. Cytologia 52: 377–385
2n 661×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Markova, M. 1983a. In IOPB chromosome number reports LXXX. Taxon 32: 509–510.
2n 741×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Dmitrieva, S. A. (2000). Karyology of the flora of Byelarus Page 42 Thesis of the Diss. Doc. Biol. Sci. Minsk. Minsk
2n 841×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tyagi, B. R. & A. A. Naqvi (1987). Relevance of chromosome number variation to yield and quality of essential oil in Mentha arvensis L. Cytologia 52: 377–385
2n 981×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tyagi, B. R. & A. A. Naqvi (1987). Relevance of chromosome number variation to yield and quality of essential oil in Mentha arvensis L. Cytologia 52: 377–385
2n 1081×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tyagi, B. R. & A. A. Naqvi (1987). Relevance of chromosome number variation to yield and quality of essential oil in Mentha arvensis L. Cytologia 52: 377–385
2n 1201×CCDB · Cave1956
CCDB · Cave1956 — Morton b
n 482×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gill, L. S. 1981. Chromosomal evolution and incidence of polyploidy in the Canadian Labiatae. Rev. Cytol. Biol. Vég., Bot. 4: 331–339.
CCDB · CromoCat 2015 — Mulligan, G.A. & W.J.Cody. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XVII]. Taxon 17(3): 286.
n 461×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~5.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type195 151 records
Wild obs. + sensor174 047
Museum / vouchered20 065
Cultivated / captive59
Other980
Origin
Native12 702
Introduced13
Range
Area of Occupancy AOO357 924 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 30 920≤1 km 27 975≤10 km 77 972>10 km 1 509
138 376 georeferenced · 35 671 without coordinates
Open the mapobservation + sensor174 047
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 1 567≤1 km 4 592≤10 km 6 571>10 km 613
13 343 georeferenced · 6 722 without coordinates
Open the institutions mapphysical evidence20 065
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4>10 km 19
23 georeferenced · 36 without coordinates
Open the mapnot free-living59
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions211 of 404 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 922 |
| LDlocation not on record | 1 323 |
| Moscow State Universitylocation not on record | 669 |
| Olocation not on record | 466 |
| BFLlocation not on record | 429 |
| DBF-NHMDlocation not on record | 414 |
| SLU Artdatabankenlocation not on record | 358 |
| Oulu, FI | 320 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 312 |
| Trondheim, NO | 291 |
| Wuzhou, CN | 282 |
| Oskarshamn, SE | 272 |
| Chongqing Museumlocation not on record | 226 |
| MeiseBGlocation not on record | 218 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 188 |
| Salzburg, AT | 187 |
| Québec, CA | 173 |
| Bronx, US | 150 |
| Adam Mickiewicz University in Poznańlocation not on record | 143 |
| Turku, FI | 132 |
| Jyväskylä, FI | 129 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 128 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 126 |
| Bergen, NO | 125 |
| Oregon State Universitylocation not on record | 117 |
| Acadia Universitylocation not on record | 108 |
| Pullman, US | 106 |
| Missoula, US | 102 |
| BIO-UNIPIlocation not on record | 97 |
| WTUlocation not on record | 94 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 92 |
| Uppsala, SE | 85 |
| Denver, US | 82 |
| Flagstaff, US | 81 |
| Kuopio, FI | 81 |
| University of New Hampshirelocation not on record | 81 |
| Philadelphia, US | 80 |
| Provincia di Livornolocation not on record | 79 |
| Uniwersytet Warszawskilocation not on record | 79 |
| Madison, US | 78 |
| BRNUlocation not on record | 78 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 77 |
| KMNlocation not on record | 75 |
| Tartu, EE | 74 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 70 |
| South Kensington, GB | 70 |
| Moscow, US | 68 |
| Spearfish, US | 67 |
| Chicago, US | 63 |
| ASUlocation not on record | 62 |
| Tallinn, EE | 62 |
| Görlitz, DE | 60 |
| University of Wisconsinlocation not on record | 60 |
| TUR-Alocation not on record | 59 |
| New Haven, US | 55 |
| Allentown, US | 53 |
| Bozeman, US | 53 |
| Toronto, CA | 48 |
| Montréal, CA | 39 |
| Uniwersytet Śląski w Katowicachlocation not on record | 38 |
| Nanjing, CN | 37 |
| Logan, US | 37 |
| Victoria, CA | 35 |
| University of Stellenboschlocation not on record | 35 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 33 |
| Université Lavallocation not on record | 33 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 31 |
| DOI/NPS, Greenbelt Parklocation not on record | 30 |
| Helsinki, FI | 30 |
| McWane Science Centerlocation not on record | 30 |
| University of Alberta Museumslocation not on record | 30 |
| Porvoo, FI | 30 |
| Lincoln, US | 29 |
| St. Paul, US | 28 |
| Xining, CN | 28 |
| Phoenix, US | 28 |
| Karlsruhe, DE | 26 |
| Provo, US | 26 |
| Wlocation not on record | 25 |
| Berlin, DE | 24 |
| Claremont, US | 24 |
| Vancouver, CA | 23 |
| Boise, US | 23 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 23 |
| Burlington, US | 22 |
| Emporia, US | 22 |
| Frankfurt am Main | 22 |
| Bern, CH | 21 |
| Riverside, US | 21 |
| GJOlocation not on record | 21 |
| Natural History Museum Rotterdamlocation not on record | 20 |
| TROMlocation not on record | 20 |
| Servico de Microbiologia e Imunologialocation not on record | 19 |
| Pocatello, US | 19 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 19 |
| Saint John, CA | 18 |
| Williamsburg, US | 18 |
| BClocation not on record | 17 |
| Montréal, CA | 17 |
| Cheney, US | 17 |
| Caldwell, US | 17 |
| UGentlocation not on record | 17 |
| Wuhan, CN | 17 |
| EL PASO, US | 16 |
| Staten Island, US | 16 |
| WINlocation not on record | 16 |
| US | 15 |
| MAlocation not on record | 15 |
| Keene State Universitylocation not on record | 15 |
| Durango, US | 15 |
| Canadian Department of Agriculturelocation not on record | 15 |
| Rovaniemi, FI | 14 |
| Tacoma, US | 14 |
| Bangkok, TH | 14 |
| PRClocation not on record | 13 |
| Orem, US | 13 |
| Hangzhou, CN | 13 |
| Podgorica, ME | 12 |
| Tilburg, NL | 11 |
| Dekalb, US | 11 |
| BSBIlocation not on record | 11 |
| Beijing, CN | 11 |
| Eastern Nevada Landscape Coalitionlocation not on record | 11 |
| Entomological Society of Latvialocation not on record | 10 |
| Uniwersytet Opolskilocation not on record | 10 |
| Paris, FR | 10 |
| USFS/BHSClocation not on record | 10 |
| NSMKlocation not on record | 10 |
| Porrentruy, CH | 10 |
| Morgantown, US | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 10 |
| Zürich, CH | 10 |
| Tula State Universitylocation not on record | 9 |
| CASlocation not on record | 9 |
| Kew, GB | 9 |
| Angwin, US | 9 |
| Yukon Universitylocation not on record | 9 |
| College Park, US | 9 |
| Millersville, US | 9 |
| UNESClocation not on record | 9 |
| nbflocation not on record | 9 |
| Saint Louis, US | 9 |
| BDBClocation not on record | 9 |
| Davenport, US | 8 |
| UNIVASFlocation not on record | 8 |
| FJIDClocation not on record | 8 |
| Los Angeles, US | 8 |
| Pittsburg, US | 8 |
| Whitewater, US | 8 |
| WNNUlocation not on record | 8 |
| Philadelphia, US | 8 |
| Stockholm, SE | 8 |
| Austin, US | 8 |
| Frauenfeld, CH | 8 |
| Lubbock, US | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| CJBGlocation not on record | 7 |
| Fargo, US | 7 |
| Forssa, FI | 7 |
| Grand Junction, US | 7 |
| GZUlocation not on record | 7 |
| UFPIlocation not on record | 7 |
| Science Museum of Minnesotalocation not on record | 7 |
| Durham, US | 7 |
| Columbia, US | 6 |
| Canberra, AU | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Barcelona, ES | 6 |
| València, ES | 6 |
| Bend, US | 6 |
| Blumenau, BR | 6 |
| Anchorage, US | 6 |
| US | 6 |
| NMBU:MINAlocation not on record | 6 |
| Bourges, FR | 5 |
| Guilin, CN | 5 |
| Mlocation not on record | 5 |
| Santa Barbara, US | 5 |
| Wellington, NZ | 5 |
| Nanjing, CN | 5 |
| Albuquerque, US | 5 |
| Odawara, JP | 5 |
| Hazara Universitylocation not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| Córdoba, AR | 5 |
| Capital Normal Universitylocation not on record | 5 |
| Criciúma, BR | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Hudson, US | 4 |
| Hamilton, US | 4 |
| H-HarzKurtlocation not on record | 4 |
| Ensenada, MX | 4 |
| San Jose, US | 4 |
| Macomb, US | 4 |
| Sion, CH | 4 |
| San Angelo, US | 4 |
| UFBAlocation not on record | 4 |
| Pamplona, ES | 4 |
| Nagasaki University - Fisherieslocation not on record | 4 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 4 |
| Waverly, US | 4 |
| Salvador, BR | 4 |
| Pamplona, ES | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| USFSlocation not on record | 4 |
| Fredericton Stock Culture Collectionlocation not on record | 4 |
| Portland, US | 4 |
| Dresden, DE | 4 |
| Glarus, CH | 4 |
| Xian, CN | 4 |
| SZUlocation not on record | 4 |
| Ypsilanti, US | 4 |
| Göteborg, SE | 3 |
| Weber State Universitylocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| Davis, US | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| San Diego, US | 3 |
| Fulda, DE | 3 |
| San Luis Obispo, US | 3 |
| Awka, NG | 3 |
| Yellowstone National Park Herbariumlocation not on record | 3 |
| Uberlândia, BR | 3 |
| Lausanne, CH | 3 |
| University of Lethbridgelocation not on record | 3 |
| Taipei, TW | 3 |
| Salamanca, ES | 3 |
| J. Rusek Collectionlocation not on record | 3 |
| Durango, MX | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| Northridge, US | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Masindi, UG | 3 |
| Washington, US | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Bando, JP | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| B.A. Bennett Herbariumlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| Chicago, US | 3 |
| Bandelier National Monumentlocation not on record | 2 |
| STNFlocation not on record | 2 |
| Guiyang, CN | 2 |
| Madrid, ES | 2 |
| Christchurch, NZ | 2 |
| Little Rock, US | 2 |
| US | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Philadelphia, US | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 2 |
| Brookings, US | 2 |
| FLADlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Minot State Universitylocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| UEMAlocation not on record | 2 |
| Brussel, BE | 2 |
| IDElocation not on record | 2 |
| NoColllocation not on record | 2 |
| Taipei, TW | 2 |
| Wuhan, CN | 2 |
| Irvine, US | 2 |
| Baltimore, US | 2 |
| Cenargenlocation not on record | 2 |
| Hermosillo, MX | 2 |
| CJBNlocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Austin, US | 2 |
| JP | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Brasília, BR | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Tuscaloosa, US | 2 |
| Tempe, US | 2 |
| Yunnan Universitylocation not on record | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Garðabær, IS | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Arcata, US | 2 |
| Ilhéus, BR | 2 |
| Kingston, US | 2 |
| Fortaleza, BR | 2 |
| Bloomington, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Santa Cruz, US | 2 |
| Chiba, JP | 2 |
| Fort Bragg, US | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Porto Velho, BR | 1 |
| Turlock, US | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Mexico City, MX | 1 |
| UNISANTAlocation not on record | 1 |
| Toyama, JP | 1 |
| Museo Achille Folettolocation not on record | 1 |
| US | 1 |
| Castelar, AR | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| VALElocation not on record | 1 |
| University of South Dakotalocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Dover, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Xiamen, CN | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| New Brunswick, US | 1 |
| FUNEDlocation not on record | 1 |
| Chaguaramas, TT | 1 |
| UFVJMlocation not on record | 1 |
| Long Beach, US | 1 |
| cslocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| UNICAMPlocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| University of Birminghamlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Elikins, US | 1 |
| Banyoles, ES | 1 |
| Trois-Rivières, CA | 1 |
| Whitehorse, CA | 1 |
| National Museum Waleslocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Boumlocation not on record | 1 |
| Central China Agricultural Universitylocation not on record | 1 |
| Maringá, BR | 1 |
| UFRRJlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Oswego, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Chapel Hill, US | 1 |
| Herb. BBGlocation not on record | 1 |
| Jaén, ES | 1 |
| Mérida, MX | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Guiyang, CN | 1 |
| Adelaide, AU | 1 |
| South China Normal Universitylocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Portland, US | 1 |
| BAYLUlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Zürich, CH | 1 |
| Tromso University Museumlocation not on record | 1 |
| SEFlocation not on record | 1 |
| Shanghai, CN | 1 |
| UNEMATlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| INFlocation not on record | 1 |
| Namur, BE | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Monastir, TN | 1 |
| Edmonton, CA | 1 |
| ENTClocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| DULlocation not on record | 1 |
| FLASlocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Sagamihara, JP | 1 |
| Mohonk Preservelocation not on record | 1 |
| Urumqi, CN | 1 |
| Sevilla, ES | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Hobart, AU | 1 |
| Metsähallituslocation not on record | 1 |
| Mexico City, MX | 1 |
| Parkville, AU | 1 |
| Decorah, US | 1 |
| JBRJlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| LfUlocation not on record | 1 |
| CSBSJUlocation not on record | 1 |
| Auckland, NZ | 1 |
| Tulane Universitylocation not on record | 1 |
| Santarém, BR | 1 |
| Walla Walla, US | 1 |
404 institutions · 18 875 of 20 065 vouchered records shown · 1 036 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA34 detections
Where the DNA of Mentha arvensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found34
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 34 detections have coordinates
Open the map9 countries0
On the bank of the River GavleÃ¥n.Pond holding water the entire yearSaturated depression with mostly bare ground…Seasonally wetland, saturated at surface in …on edge of pondFlooded river edge amongst Carex saxatilis.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 13.9–20.7
Seasonal swing summer↔winter23.9 °C
Max temp (day)21.1 °C 17.0–26.9
Min temp (night)12.2 °C 7.70–15.6
Precipitation79.5 mm/mo 28.4–109
Air humidity59.5 % 48.4–62.6
Moisture balance-28.2 mm/mo -91.0–6.80
Vapour deficit748 Pa 608–1,188
Wind speed2.70 m/s 2.10–4.90
Cloud cover42.0 % 22.6–61.8
CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.