Membracis mexicana

Guérin-Méneville · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Membracidae/Membracis

At a glance

Occurrence records2 686

Data sources5

Biological traits0

DNA specimens58

eDNA detections58

Sources5 archives

Databases and archives Membracis mexicana's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 686 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI58 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 686 records

Environmental DNA1 datasets · 0 countries58 detections

DNA & barcodingBOLD58 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Membracis mexicana has left across the world's sequence archives.

At a glance

DNA specimens58

Marker genes1

eDNA detections58

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P367 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

12Tmostly conserved

26Cmostly conserved

30Gvariable

33Amostly conserved

44Tmostly conserved

54Tvariable

61Gmostly conserved

72Tmostly conserved

90Amostly conserved

93Cvariable

94Tmostly conserved

108Tvariable

114Tmostly conserved

182Avariable

198Tmostly conserved

202Tmostly conserved

204Gvariable

225Tvariable

231Cmostly conserved

247Tmostly conserved

258Gvariable

276Gmostly conserved

286Tmostly conserved

324Cmostly conserved

327Avariable

339Gmostly conserved

342Tmostly conserved

345Tvariable

351Avariable

354Cmostly conserved

361Tmostly conserved

TCTAGATCTATTATTGAATGTGGGGCGGGGACAGGTTGGACTGTATACCCCCCTCTCTCTGGTAATACCGCTCATTCTGGGGCTAGAGTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 54 variants.

Diversity (π)3.6%

Haplotypes54

BINs0

Most divergent pair10.4%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 686 records

Wild obs. + sensor2 494

Museum / vouchered192

Range

Area of Occupancy AOO4 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 239≤1 km 323≤10 km 177>10 km 140

1 879 georeferenced · 615 without coordinates

Open the mapobservation + sensor2 494

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 8≤1 km 2≤10 km 16

26 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	88
Tapachula, MX	42
OSUClocation not on record	21
Instituto de Fitosanidad, Colegio de Postgraduados, Campus Montecillolocation not on record	14
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	12
San Luis Potosí, MX	4
Pontificia Universidad Javeriana (PUJ)location not on record	3
Champaign, US	2
Ciudad de México, MX	2
ASUlocation not on record	1
Toronto, CA	1
Colorado State Universitylocation not on record	1
MX	1

13 institutions · 192 of 192 vouchered records shown

09Environmental DNA58 detections

Where the DNA of Membracis mexicana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found58

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 58 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Membracis mexicana

At a glance

Sources5 archives

At a glance

Record type2 686 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 686 records