Melogramma gyrosum

(Schwein.) Tul. & C.Tul. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Xylariales/Melogrammataceae/Melogramma

At a glance

Occurrence records18

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Melogramma gyrosum's data was compiled from.

GBIFGlobal Biodiversity Information Facility18 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF18 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition5 compounds

Compounds documented for Melogramma gyrosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cytochalasan alkaloids5

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(16-Benzyl-5,12-dihydroxy-5,7,14-trimethyl-13-methylidene-18-oxo-17-azatricyclo[9.7.0.01,15]octadeca-3,9-dien-2-yl) acetate	present	LOTUS
(17-Benzyl-5-hydroxy-5,7,14,15-tetramethyl-19-oxo-13-oxa-18-azatetracyclo[9.8.0.01,16.012,14]nonadeca-3,9-dien-2-yl) acetate	present	LOTUS
(1R,2R,3E,5R,7S,9E,11R,12S,15R,16S)-16-benzyl-2,5,12-trihydroxy-13-(hydroxymethyl)-5,7,14-trimethyl-17-azatricyclo[9.7.0.01,15]octadeca-3,9,13-trien-18-one	present	LOTUS
[16-Benzyl-5,12-dihydroxy-13-(hydroxymethyl)-5,7,14-trimethyl-18-oxo-17-azatricyclo[9.7.0.01,15]octadeca-3,9,13-trien-2-yl] acetate	present	LOTUS
CID 3555370	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melogramma gyrosum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSL42448.1 ↗237 bp

ACGT

TCATTGCTGGAACTGTGCCCTCGCGGGCACAACCCCAGATACCCTTTGTGAACTTATACCATTTTATCGTTGCCTCGGCGCTGAGCTGGG …

Endothia gyrosa internal transcribed spacer, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type18 records

Wild obs. + sensor3

Museum / vouchered14

Other1

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 3≤10 km 5>10 km 4

12 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Hobart, AU	2
Bronx, US	2
Catholic University of Pekinglocation not on record	2
PHlocation not on record	2
Brown Universitylocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Champaign, US	1

8 institutions · 14 of 14 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)