Melocactus ernestii

Vaupel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Melocactus

At a glance

Occurrence records246

Data sources9

Biological traits11

DNA specimens1

eDNA detections0

Sources9 archives

Databases and archives Melocactus ernestii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility246 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF246 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 44

01Narrative

miniatur|Melocactus ernestii im Habitat Melocactus ernestii ist eine Pflanzenart aus der Gattung Melocactus in der Familie der Kakteengewächse (Cactaceae). Das Artepitheton ehrt den deutschen Botaniker und Entdecker Ernst H. G. Uhle (1854–1915).Urs Eggli, Leonard E. Newton: Etymological Dictionary of Succulent Plant Names. Birkhäuser 2004, ISBN 3-540-00489-0, S. 78.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.258 mg

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melocactus ernestii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOP188758.1 ↗470 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCCGCGCCCGGCCC …

Melocactus ernestii isolate L3E2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1

animal barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melocactus ernestii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 445×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt

CCDB · ipcn-api-dl — Das, A. B., S. Mohanty & P. Das. 1998. Variation in karyotype and 4C DNA content in six species of Melocactus of the family Cactaceae. Cytologia 63: 9–16.

CCDB · ipcn-api-dl — Das, A. B., S. Mohanty & P. Das. 1998. Interspecific variation in nuclear DNA content and chromosome analysis in Melocactus. Cytologia 63: 239–247.

CCDB · iapt — IAPT/IOPB Chromosome Data 18

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type246 records

Wild obs. + sensor130

Museum / vouchered116

Origin

Native66

Range

Area of Occupancy AOO536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 37≤1 km 19≤10 km 29>10 km 5

90 georeferenced · 40 without coordinates

Open the mapobservation + sensor130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 116 records without

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	17
UNIVASFlocation not on record	14
Universidade Federal do Rio Grande do Nortelocation not on record	12
UFBAlocation not on record	10
Universidade Federal do Vale do São Franciscolocation not on record	9
Feira de Santana, BR	9
Kew, GB	8
Departamento de Sistematica e Ecologialocation not on record	6
Cruz das Almas, BR	5
USP-IBlocation not on record	5
CEPLAClocation not on record	3
Universidade Federal de Sergipe (UFS)location not on record	3
UFSCarlocation not on record	2
JBRJlocation not on record	2
UFRPElocation not on record	2
Chaguaramas, TT	2
HACAMlocation not on record	1
UnBlocation not on record	1
UNICAMPlocation not on record	1
Salvador, BR	1
UFMGlocation not on record	1
UESBlocation not on record	1
Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record	1

23 institutions · 116 of 116 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)