Melicope broadbentiana

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Melicope

At a glance

Occurrence records313

Data sources8

Biological traits21

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Melicope broadbentiana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility313 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Chemical compositionLOTUS · NPASS28 compounds

Occurrence & distributionGBIF313 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Flower detail Fruit Melicope broadbentiana, commonly known as false euodia, is a species of shrub or tree in the family Rutaceae and is endemic to Queensland. It has simple leaves, trifoliate leaves or both, and small white flowers borne in short panicles in leaf axils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length10.5 mm

Fruit width5.5 mm

Leaf length72.5 mm

Leaf width27.5 mm

Petiole length2 cm

Plant height9 m

Seed length5 mm

Seed mass27 mg

Seed width3.5 mm

Life cycle & reproduction4

Deciduousnessevergreen

Flowering timeyyyyyyyyynny

Life spanperennial

Sex typedioecious

Habitat & environment7

Climatewet tropical

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub tree

⚠ sources differ — AusTraits: shrub tree · TRY: woody

Leaf compoundnesscompound simple

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition28 compounds

Compounds documented for Melicope broadbentiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols8

Humulane sesquiterpenoids2

Acyclic monoterpenoids1

Flavanones1

Flavan-3-ols1

Documented compounds28 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3Z,7Z,11S)-1,5,5,8-tetramethyl-12-oxabicyclo[9.1.0]dodeca-3,7-diene	present	LOTUS
(2R,3S)-2-(4-hydroxyphenyl)-5-methoxy-8,8-dimethyl-3,4,9,10-tetrahydro-2H-pyrano[2,3-h]chromen-3-ol	present	NPASS
(3S,4S)-4-ethyl-3-hydroxy-4-methyldihydro-2(3H)-furanone	present	NPASS
12-Oxabicyclo[9.1.0]dodeca-3,7-diene, 1,5,5,8-tetramethyl-, (1R,3E,7E,11R)-	present	LOTUS
2,4-dihydroxy-3-[(2R)-2-hydroxy-3-methylbut-3-enyl]-6-methoxybenzaldehyde	present	NPASS
3,5,4'-Trihydroxy-6'',6''-dimethylpyrano[2,3:7,6]flavone	present	NPASS
3-[[(2S)-3,3-dimethyloxiran-2-yl]methyl]-2,4-dihydroxy-6-methoxybenzaldehyde	present	NPASS
4,5-Di-O-methyl-8-prenylafzelechin-4beta-ol	present	NPASS
[(1R,2R,3R,4R,5S,6S)-4-acetyloxy-2,3-dihydroxy-5,6-bis[[(Z)-2-methylbut-2-enoyl]oxy]cyclohexyl] (Z)-2-methylbut-2-enoate	present	NPASS
[(1R,2S,3R,4R,5R,6R)-3,4-bis(2,3-dimethylbut-2-enoyloxy)-2,5,6-trihydroxycyclohexyl] 2,3-dimethylbut-2-enoate	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melicope broadbentiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHG971341.1 ↗331 bp

ACGT

AGGGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCAAAACCTGCCCAGCAGAACGACCTGTGAACTCTTTAAA …

Melicope broadbentiana genomic DNA containing 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene, specimen voucher Gray 435

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type313 records

Wild obs. + sensor6

Museum / vouchered289

Other18

Origin

Native16

Introduced3

Range

Area of Occupancy AOO584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2≤10 km 1

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 44≤1 km 48≤10 km 119>10 km 18

229 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence289

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	86
Smithfield, AU	75
Canberra, AU	50
Museo Entomologico de Leonlocation not on record	22
Mount Annan, AU	18
James Cook Townsvillelocation not on record	9
Hobart, AU	5
Palmerston, AU	4
Armidale, AU	3
Parkville, AU	2
Saint Louis, US	2
Kew, GB	1
University of the Sunshine Coastlocation not on record	1
La Trobe Universitylocation not on record	1

14 institutions · 279 of 289 vouchered records shown · 10 without an institution code

09Environmental DNA2 detections

Where the DNA of Melicope broadbentiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter8.30 °C

Max temp (day)19.8 °C

Min temp (night)11.2 °C

Precipitation36.9 mm/mo

Air humidity60.1 %

Moisture balance-69.4 mm/mo

Vapour deficit690 Pa

Wind speed3.40 m/s

Cloud cover29.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)