Melichrus erubescens

A.Cunn. ex DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Melichrus

At a glance

Occurrence records1 324

Data sources6

Biological traits28

DNA specimens3

eDNA detections2

Sources6 archives

Databases and archives Melichrus erubescens's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 324 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF1 324 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesAusTraitsWCVPGIFTTRY

Size & morphology8

Fruit length4.5 mm

Leaf length20.5 mm

Leaf width2.8 mm

Petiole length0.125 cm

Plant height0.75 m

Plant height max1.2 m

Plant height min0.3 m

Seed mass98.9 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeanimal

Flowering timenyyyyyyyyynn

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melichrus erubescens has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC197092.1 ↗634 bpAustralia

ACGT

TCAAAAGTCCGCCAATCAAAGAACACCCGCGAACTTGTCTCTACATATTATTGGGAGTAAAGCGATGGTCGCGGCCTTGTTGCCTAGTCT …

Melichrus erubescens isolate 1604 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 324 records

Wild obs. + sensor1 074

Museum / vouchered242

Cultivated / captive2

Other6

Origin

Native98

Range

Area of Occupancy AOO2 904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 987≤1 km 11≤10 km 17>10 km 5

1 020 georeferenced · 54 without coordinates

Open the mapobservation + sensor1 074

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 71≤1 km 27≤10 km 64>10 km 15

177 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence242

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	98
Armidale, AU	41
Canberra, AU	37
NSW Dept of Planning, Industry and Environmentlocation not on record	27
Museo Entomologico de Leonlocation not on record	15
Brisbane, AU	11
Hobart, AU	3
Adelaide, AU	3
NSW Office of Environment and Heritagelocation not on record	2
John T. Waterhouse Herbariumlocation not on record	2
Auckland, NZ	1
Palmerston, AU	1

12 institutions · 241 of 242 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Melichrus erubescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melichrus erubescens

At a glance

Sources6 archives

Size & morphology8

Life cycle & reproduction7

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Record type1 324 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 324 records