Melica picta

K.Koch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Melica

At a glance

Occurrence records2 140

Data sources9

Biological traits27

DNA specimens1

eDNA detections2

Sources9 archives

Databases and archives Melica picta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF2 140 records

Environmental DNA2 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

La melica macchiata è una pianta angiosperma monocotiledone appartenente alla famiglia delle Poacee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.225 m

⚠ sources differ — GIFT: 0.225 m · LEDA: 0.225 m · TRY: 0.55 m

Plant height generative0.45 m

Plant height max0.6 m

Plant height min0.3 m

Seed mass1.88 mg

Life cycle & reproduction11

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

Flowering endJun

Flowering startMay

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Seed number5

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, shrubberies

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits2

Diaspore typeone-seeded generative dispersule

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica picta has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSFM179418.1 ↗572 bp

ACGT

TAACAAAACAGACCGCGCTCACGTCATCCATCACGCCAGCGGCGGCATCGCCGTCGTTCGGCAAACACCCCAACCATACCCTCCTCGGAG …

Melica picta ITS1 (partial), 5.8S rRNA gene and ITS2 (partial)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melica picta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · book-fedorov · CCDB · iapt · CCDB · Original-count

CCDB · book-fedorov — Doulat 1943

CCDB · iapt — IAPT/IOPB Chromosome Data 35

CCDB · Original-count — Winterfeld, G., Schneider, J., Becher, H., Dickie, J., Röser, M. (2015). Karyosystematics of the Australasian stipoid grass Austrostipa and related genera: chromosome sizes, ploidy, chromosome base numbers, and phylogeny. Austral. Syst. Bot. 28: 145–159. doi: /10.1071/SB14060

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 140 records

Wild obs. + sensor1 544

Museum / vouchered552

Cultivated / captive1

Other43

Origin

Native18

Range

Area of Occupancy AOO4 108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 376≤1 km 104≤10 km 298>10 km 6

784 georeferenced · 760 without coordinates

Open the mapobservation + sensor1 544

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 33≤1 km 56≤10 km 79>10 km 56

224 georeferenced · 328 without coordinates

Open the institutions mapphysical evidence552

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	147
BFLlocation not on record	106
Helsinki, FI	52
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	33
Turku, FI	33
GZUlocation not on record	22
Dresden, DE	14
PRClocation not on record	11
BRNUlocation not on record	11
Mlocation not on record	10
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	10
Department of Bacteriology, University of Wisconsinlocation not on record	9
Görlitz, DE	8
GJOlocation not on record	8
Guangzhou, CN	6
Uppsala, SE	5
Wlocation not on record	5
Oulu, FI	5
Berlin, DE	4
LfUlocation not on record	4
Porvoo, FI	3
TUR-Alocation not on record	3
Oskarshamn, SE	3
IFR-DNFlocation not on record	2
Kuopio, FI	2
No collectionlocation not on record	2
Provincia di Livornolocation not on record	2
Xiamen, CN	2
Jyväskylä, FI	2
H-AkrKGlocation not on record	2
PrivatHerblocation not on record	2
H-Schuhwlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
H-Adlerlocation not on record	2
LDlocation not on record	2
Stockholm, SE	1
Salamanca, ES	1
MAlocation not on record	1
Zürich, CH	1
John May Museum of Natural Historylocation not on record	1
Barcelona, ES	1
València, ES	1
Bourges, FR	1

43 institutions · 544 of 552 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Melica picta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.6 °C 10.6–10.6

Seasonal swing summer↔winter22.6 °C

Max temp (day)13.9 °C

Min temp (night)7.80 °C

Precipitation66.6 mm/mo

Air humidity64.9 %

Moisture balance13.9 mm/mo

Vapour deficit449 Pa

Wind speed3.90 m/s

Cloud cover47.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melica picta

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction11

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Other traits2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 140 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 140 records