Melica nutans
speciesAt a glance
Occurrence records201 479
Data sources12
Biological traits46
DNA specimens24
eDNA detections13
Sources12 archives
Databases and archives Melica nutans's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility201 479 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics24 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources46 traits
Occurrence & distributionGBIF201 479 records
Environmental DNA1 datasets · 6 countries13 detections
DNA & barcodingBOLD · NCBI24 specimens
Genome at a glanceCCDB · GoaT2n = 18
01Narrative
Melica grandiflora is a species of grass that can be found in Japan, Korea and China.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology11
Leaf mass12.91 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 402 mm² · GIFT: 402 mm²
Plant height0.225 m
⚠ sources differ — GIFT: 0.225 m · LEDA: 0.225 m · TRY: 0.481 m
Plant height generative0.599 m
Plant height max0.9 m
Plant height min0.3 m
Seed length2.5 mm
Seed mass2.25 mg
⚠ sources differ — TRY: 2.25 mg · LEDA: 2.03 mg · GIFT: 2.48 mg
Seed volume2.1 mm³
Seed volume max2.1 mm³
Seed volume min2.1 mm³
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJun
Flowering startMay
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number26
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 200 m
Elevation mean1 825 m
Elevation min500 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
⚠ sources differ — GIFT: herb · TRY: graminoid
Habitat GIFTforest, shrubberies
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf c462 mg/g
Leaf dry-matter content (LDMC)316 mg/g
⚠ sources differ — TRY: 316 mg/g · LEDA: 340 mg/g
Leaf n23 mg/g
Leaf p1.7 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)9.8 mm²/mg
⚠ sources differ — TRY: 9.8 mm²/mg · LEDA: 28.8 mm²/mg · GIFT: 28.73 mm²/mg
Other traits1
Diaspore typefruit
05DNA & barcoding24 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica nutans has left across the world's sequence archives.
At a glance
DNA specimens24
Marker genes6
GenBank sequences10
eDNA detections13
Countries6
The DNA barcodea real sequence read deposited for this species
CGCCATAACACGCTCCAAACCCCCCAAGCTGGGTGCCGGACGCGGCGTCTGGCCTTCCGTGCCGCGAGGCGCGGTAGGCCGAAGATCGGG …
Melica nutans voucher TJ-3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL8★rbcLa★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Melica nutans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–182n range18median18mode53records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1853×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Nota sobre cariologa de Gramineas silvestres espaolas. Fernndez Piqueras, J.Fontqueria3: 11-12(1983).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4511
CCDB · fl-europaea — V. Sorsa, 1962
CCDB · poland — Skali?ska M., Pogan E. et al. 1971 a. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov. Ser. Bot. 14, 199-211.
CCDB · poland — Frey L., Mirek Z. and Mizianty M. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 23, 317-325.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1983a. New chromosome numbers for vascular plants from the islands of Peter the Great Bay (Primorye Territory). Bot. Zhurn. SSSR 68 (12): 1655–1662.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Fernández Piqueras, J. 1983. Nota sobre cariología de gramíneas silvestres españolas. Fontqueria 3: 11–12.
CCDB · ipcn-api-dl — Frey, L., Z. Mirek & M. Mizianty. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 23: 317–325.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Chromosome studies in some flowering plants collected in the French Alps (Hante Savoie). Rev. Gen. Bot. 77: 487-497.
CCDB · book-ipcn67-71 — SKALINSKA, M. E. POGAL ET AL. 1971. Further studies in chromosome numbers of Polish Angiosperms. Ninth contribution. Acta Biol. Cracov., Ser. Bot. 14: 198-213.
CCDB · book-ipcn75-78 — Sokolovskaya & Probatova 1976a
CCDB · book-ipcn75-78 — Dmitrieva et al. 1977
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Katter- mann, G. 1930 ; Tischler, G. 1934 ; Rohweder, H. 1937 ; Doulat, B. 1943 ; L6ve, A. & LOve, D. l944b; Tateoka, T. 1953 ; Hubbard, C.E. 1954 ; Sokolovskaya, A.P. (Fedorov) ; Sorsa, V. 1962; Laane, M.M. 1969b ; Gadella, T.W.J. & Kliphuis, B. 197Gb ; Skalinska, M. & Pogan, E. 1971 ; Mehra, P.N. & Sharma, M.L. 1977a
CCDB · eflora
CCDB · book-fedorov — ABAYJIOB 1928
CCDB · book-fedorov — Kattermann 1930
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Doulat 1943
CCDB · book-fedorov — Love A., Love D. 1944b
CCDB · book-fedorov — Tateoka 1953
CCDB · book-fedorov — Hubbard 1954
CCDB · book-fedorov — CoKononci;aa 19o0a
CCDB · book-fedorov — Sorsa V. 1962
CCDB · book-atlas-flowering-plants — Tateoka 1954
CCDB · Cave1963 — Sorsa 1962
+12 more references
2n 91×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
n 92×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · book-ipcn75-78 — Mehra & Sharma 1977
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type201 479 records
Wild obs. + sensor182 348
Museum / vouchered16 539
Cultivated / captive90
Other2 502
Origin
Native2 443
Introduced7
Range
Area of Occupancy AOO300 776 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy66% within 1 km
≤100 m 55 525≤1 km 44 006≤10 km 50 189>10 km 1 538
151 258 georeferenced · 31 090 without coordinates
Open the mapobservation + sensor182 348
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 907≤1 km 3 583≤10 km 7 876>10 km 957
13 323 georeferenced · 3 216 without coordinates
Open the institutions mapphysical evidence16 539
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 3
4 georeferenced · 86 without coordinates
Open the mapnot free-living90
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 192 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 9 191 |
| Helsinki, FI | 621 |
| BFLlocation not on record | 537 |
| Moscow State Universitylocation not on record | 482 |
| Olocation not on record | 434 |
| LDlocation not on record | 370 |
| Sanda, JP | 283 |
| Salzburg, AT | 279 |
| Trondheim, NO | 266 |
| Uppsala, SE | 232 |
| Oulu, FI | 172 |
| Turku, FI | 168 |
| Bergen, NO | 151 |
| TROMlocation not on record | 143 |
| SLU Artdatabankenlocation not on record | 127 |
| KMNlocation not on record | 120 |
| Tartu, EE | 119 |
| Oskarshamn, SE | 110 |
| MeiseBGlocation not on record | 107 |
| BIO-UNIPIlocation not on record | 107 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 102 |
| Jyväskylä, FI | 93 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 86 |
| IFR-DNFlocation not on record | 81 |
| Nagano City, JP | 62 |
| Görlitz, DE | 58 |
| Toyama, JP | 56 |
| Tallinn, EE | 56 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 55 |
| Irkutsk State Universitylocation not on record | 53 |
| Shinshu Universitylocation not on record | 49 |
| Kuopio, FI | 49 |
| BRNUlocation not on record | 44 |
| Dresden, DE | 42 |
| Akita Prefectural Museumlocation not on record | 38 |
| Provincia di Livornolocation not on record | 38 |
| Odawara, JP | 34 |
| Tomioka, JP | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 29 |
| Bern, CH | 28 |
| TUR-Alocation not on record | 26 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 26 |
| Kochi, JP | 23 |
| GZUlocation not on record | 22 |
| Barcelona, ES | 22 |
| KIRMlocation not on record | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Porvoo, FI | 21 |
| Mlocation not on record | 20 |
| Tsukuba, JP | 20 |
| Uniwersytet Warszawskilocation not on record | 18 |
| KURAlocation not on record | 18 |
| Berlin, DE | 17 |
| Kandalaksha State Nature Reservelocation not on record | 17 |
| KR | 17 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 15 |
| Bando, JP | 15 |
| GJOlocation not on record | 15 |
| BDBClocation not on record | 14 |
| Kyoto Universitylocation not on record | 13 |
| Chiba, JP | 13 |
| Porrentruy, CH | 13 |
| Zürich, CH | 13 |
| KOMlocation not on record | 12 |
| Tokushima, JP | 12 |
| National Institute of Biological Resourceslocation not on record | 12 |
| Rovaniemi, FI | 11 |
| SWlocation not on record | 11 |
| PRClocation not on record | 11 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 11 |
| Wlocation not on record | 11 |
| Sendai, JP | 10 |
| Winterthur, CH | 10 |
| South Kensington, GB | 10 |
| PrivatHerblocation not on record | 10 |
| Uniwersytet Jagiellońskilocation not on record | 9 |
| Zürich, CH | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Frankfurt am Main | 9 |
| Beijing, CN | 9 |
| J.F.Oberlin Universitylocation not on record | 9 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 9 |
| Otaru, JP | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| Karlsruhe, DE | 8 |
| BClocation not on record | 8 |
| Philadelphia, US | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| JP | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| València, ES | 7 |
| DBF-NHMDlocation not on record | 7 |
| Omachi Alpine Museumlocation not on record | 7 |
| Fukushima Universitylocation not on record | 7 |
| ENTClocation not on record | 6 |
| nbflocation not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Stockholm, SE | 6 |
| Glarus, CH | 6 |
| H-Schuhwlocation not on record | 6 |
| Christchurch, NZ | 6 |
| Korea National Arboretumlocation not on record | 5 |
| Taipei, TW | 5 |
| Nishihara, JP | 5 |
| Uniwersytet w Białymstokulocation not on record | 5 |
| Iwate Prefectural Museumlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Nishihara, JP | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| Auckland, NZ | 5 |
| Denver, US | 5 |
| Saint Louis, US | 5 |
| Frauenfeld, CH | 5 |
| BSBIlocation not on record | 5 |
| SZUlocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Logan, US | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| Forssa, FI | 4 |
| Herb. BBGlocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| Obihiro Centennial City Museumlocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| IWEP FEB RASlocation not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Bourges, FR | 3 |
| WTUlocation not on record | 3 |
| MAlocation not on record | 3 |
| GMBAlocation not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Plocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Ivano-Frankove, UA | 2 |
| Durham, US | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| Salamanca, ES | 2 |
| Bloomington, US | 2 |
| Xining, CN | 2 |
| DMZ botanic gardenlocation not on record | 2 |
| Göteborg, SE | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| H-AkrKGlocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Burlington, US | 2 |
| 东北师范大学自然博物馆location not on record | 2 |
| Nanjing, CN | 2 |
| Vitoria, ES | 2 |
| Kunming, CN | 1 |
| IPA/SPlocation not on record | 1 |
| Xian, CN | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Pamplona, ES | 1 |
| Namur, BE | 1 |
| BGBMlocation not on record | 1 |
| Sagamihara, JP | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Coimbra, PT | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Xiamen, CN | 1 |
| Flagstaff, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Bangkok, TH | 1 |
| Elocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| University of California at Berkeleylocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| Sion, CH | 1 |
| NMBU:MINAlocation not on record | 1 |
| The Sandakan Herbarium, Forest Research Centrelocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Urumqi, CN | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Guangzhou, CN | 1 |
| DNSMlocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Madrid, ES | 1 |
| Guilin, CN | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
192 institutions · 16 072 of 16 539 vouchered records shown · 376 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Melica nutans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.3 °C 8.70–15.8
Seasonal swing summer↔winter20.4 °C
Max temp (day)15.0 °C 10.2–19.6
Min temp (night)8.30 °C 5.10–12.1
Precipitation87.9 mm/mo 37.6–140
Air humidity62.8 % 58.2–69.5
Moisture balance-12.0 mm/mo -64.3–51.3
Vapour deficit532 Pa 343–732
Wind speed3.90 m/s 2.80–7.20
Cloud cover48.8 % 38.4–64.2
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.