Melica macra

Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Melica

At a glance

Occurrence records432

Data sources8

Biological traits16

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Melica macra's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF432 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Melica macra is a species of grass that can be found in Argentina, Brazil, and Uruguay.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.421 mg

Seed mass max0.42 mg

Seed mass min0.42 mg

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Limpo

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica macra has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPZ098630.1 ↗134 717 bpArgentina · 1985

ACGT

ATACCCAATATCTTGCTGAAACAAGATATTGGGTATTTCTGGCTTTCCTTTCTTCAAAAAATCCTATATGTTAAGAAAAAAAACCTTATC …

Melica macra voucher NY chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Melica macra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Stebbins (Myers 1947)

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type432 records

Wild obs. + sensor114

Museum / vouchered317

Other1

Origin

Native46

Range

Area of Occupancy AOO840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 41≤1 km 24≤10 km 6>10 km 2

73 georeferenced · 41 without coordinates

Open the mapobservation + sensor114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence317

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	68
San Isidro, AR	66
Laboratory of Palaeontologylocation not on record	44
Fundación Miguel Lillolocation not on record	32
Ciudad Autónoma de Buenos Aires, AR	28
Castelar, AR	22
BAlocation not on record	11
Corrientes, AR	9
Universidad Nacional del Litorallocation not on record	6
Blumenau, BR	6
PUC-RSlocation not on record	4
MVFAlocation not on record	3
Kew, GB	2
Bronx, US	2
Saint Louis, US	2
University of Stellenboschlocation not on record	2
Bloomington, US	2
Universidade Federale do Rio Grande do Sullocation not on record	2
Brasília, BR	1
Berlin, DE	1
MAlocation not on record	1
Museo de La Platalocation not on record	1
Auckland, NZ	1
Cenargenlocation not on record	1

24 institutions · 317 of 317 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)