Melica fugax

Bol. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Melica

At a glance

Occurrence records410

Data sources10

Biological traits10

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Melica fugax's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Melica fugax is a species of grass known by the common names little oniongrass and little melic. It is native to western North America where it usually grows in volcanic soils in forest and plateau habitat from British Columbia to the Sierra Nevada and North California Coast Ranges in California. Melica fugax is a perennial bunchgrass growing up to 60 centimeters tall. The stems have clusters of onionlike corms at the bases similar to oniongrass (Melica bulbosa). The inflorescence is a narrow or spreading series of spikelets.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica fugax has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences6

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216760.1 ↗342 bpCanada · 2004

ACGT

TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCTAG …

Melica fugax voucher CCDB-24911-D09 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melica fugax carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-fedorov

CCDB · book-fedorov — Stebbins, Love 194.1

CCDB · book-fedorov — Boyle 1945

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type410 records

Wild obs. + sensor7

Museum / vouchered403

Range

Area of Occupancy AOO1 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 5 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 21≤1 km 125≤10 km 93>10 km 5

244 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence403

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	47
Corvallis, US	43
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	41
WTUlocation not on record	28
Moscow, US	23
Claremont, US	19
Pullman, US	17
Caldwell, US	17
Bronx, US	13
Logan, US	12
Arcata, US	11
Boise, US	10
Henderson, US	8
Flagstaff, US	6
Ashland, US	5
Angwin, US	4
Bend, US	4
Wuzhou, CN	4
Riverside, US	4
Pocatello, US	3
Canadian Department of Agriculturelocation not on record	3
San Diego, US	3
CASlocation not on record	2
Saint Louis, US	2
Bureau of Land Management, Medford District Officelocation not on record	2
San Luis Obispo, US	2
Truckee, US	2
University of British Columbia, Herbariumlocation not on record	2
Vancouver, CA	2
ASUlocation not on record	2
STNFlocation not on record	1
VALElocation not on record	1
Cheney, US	1
Denver, US	1
US	1
Tampa, US	1
Provo, US	1
Mississippi State, US	1
GAlocation not on record	1
SEFlocation not on record	1
KNFHClocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Santa Barbara, US	1

43 institutions · 354 of 403 vouchered records shown · 49 without an institution code

09Environmental DNA2 detections

Where the DNA of Melica fugax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Base of small rock outcrop on exposed rocky …Dry, 50% southeast-facing, light silty dirt …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.3 °C 12.8–15.7

Seasonal swing summer↔winter17.4 °C

Max temp (day)20.4 °C 19.7–21.1

Min temp (night)9.00 °C 7.10–10.8

Precipitation75.9 mm/mo 59.7–92.0

Air humidity57.6 % 56.4–58.8

Moisture balance-61.0 mm/mo -86.0–-36.0

Vapour deficit695 Pa 650–739

Wind speed2.90 m/s 2.30–3.50

Cloud cover35.6 % 34.4–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)