Melica californica

Scribn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Melica

At a glance

Occurrence records1 152

Data sources11

Biological traits96

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Melica californica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources96 traits

Occurrence & distributionGBIF1 152 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Melica californica is a species of grass known by the common name California melic.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height1.2 m

Seed mass1.4 mg

Seed mass max1.66 mg

Seed mass min1.17 mg

Life cycle & reproduction25

After harvest regrowth rateSlow

Bloom periodSummer

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life formperennial

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formhemicryptophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateSlow

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureCoarse

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDABunch

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min10 in

Shape and orientationSemi-Erect

Small grainNo

Woodinessnon-woody

Physiology & chemistry23

Anaerobic toleranceLow

C:N ratioMedium

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min240 days

Leaf c395 mg/g

Leaf dry-matter content (LDMC)512 mg/g

Leaf n20.5 mg/g

Moisture useLow

Nitrogen fixation levelNone

Precipitation max24 in

Precipitation min14 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7.5 pH

Soil pH min6 pH

Specific leaf area (SLA)11.15 mm²/mg

Temperature min7 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productYes

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalMedium

Palatable graze animalHigh

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound300 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica californica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSL36518.1 ↗595 bp

ACGT

AGGTGACCCTAACCAAAACAGACCGCGCTCACGTCATCCATCATTGCCTGCGGCGGCATCGCCGTCGTTCGGCAAACACCCCAACCATGC …

Melica californica Scribner rDNA internal transcribed spacer

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melica californica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-fedorov

CCDB · book-fedorov — Stebbins, Love 1941

CCDB · book-fedorov — Boyle 1945

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 152 records

Wild obs. + sensor270

Museum / vouchered882

Origin

Native57

Range

Area of Occupancy AOO3 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 187≤1 km 9≤10 km 10>10 km 6

212 georeferenced · 58 without coordinates

Open the mapobservation + sensor270

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 28≤1 km 263≤10 km 243>10 km 7

541 georeferenced · 341 without coordinates

Open the institutions mapphysical evidence882

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis, US	211
Claremont, US	81
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	59
San Luis Obispo, US	46
Riverside, US	42
Santa Barbara, US	41
Canadian Department of Agriculturelocation not on record	31
Arcata, US	29
US	22
Angwin, US	20
CASlocation not on record	15
Santa Cruz, US	14
Fredericton Stock Culture Collectionlocation not on record	14
Logan, US	12
Musee des Dinosaures d'Esperaza (Aude)location not on record	12
Los Angeles, US	9
San Diego, US	7
San Jose, US	6
Wuzhou, CN	5
University of Stellenboschlocation not on record	4
Northridge, US	3
Saint Louis, US	3
San Angelo, US	2
Ashland, US	2
Istituto Agrario Castelnuovolocation not on record	2
Tampa, US	2
Bloomington, US	2
Long Beach, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
Chongqing Museumlocation not on record	1
Fort Bragg, US	1
Provo, US	1
Macomb, US	1
STNFlocation not on record	1
Bend, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
ASUlocation not on record	1

37 institutions · 706 of 882 vouchered records shown · 176 without an institution code

09Environmental DNA1 detections

Where the DNA of Melica californica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melica californica

At a glance

Sources11 archives

Size & morphology4

Life cycle & reproduction25

Diet & foraging1

Habitat & environment24

Physiology & chemistry23

Uses & economy15

Other traits4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 152 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 152 records