Melica bulbosa

Porter & J.M.Coult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Melica

At a glance

Occurrence records744

Data sources10

Biological traits92

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Melica bulbosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility744 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources92 traits

Occurrence & distributionGBIF744 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Melica bulbosa là một loài thực vật có hoa trong họ Hòa thảo. Loài này được Porter & J.M.Coult. mô tả khoa học đầu tiên năm 1874.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology2

Plant height0.55 m

Seed mass2.26 mg

Life cycle & reproduction26

After harvest regrowth rateSlow

Bloom periodLate Spring

Coppice potentialNo

Deciduousnessdeciduous

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endSummer

Growth rate USDAModerate

Life formperennial or bulbous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbYes

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityNo

Seed spread rateSlow

Seedling vigorLow

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDABunch

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry20

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceHigh

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min100 days

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max35 in

Precipitation min20 in

Protein potentialLow

Salinity toleranceLow

Shade toleranceMedium

Soil pH max8 pH

Soil pH min5.5 pH

Temperature min-43 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityField Collections Only

Fodder productYes

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalHigh

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound200 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceLow

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica bulbosa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ496333.1 ↗633 bpUSA · 1983

ACGT

TGTGACCCTAACCAAAACAGACCGTGCTCACGTCATCCATCACGCCTGCGGCGGCATCGCCGTCGTTCGGCAAACACCCCAACCATGCCC …

Melica bulbosa voucher M22 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melica bulbosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Boyle 1945

CCDB · book-atlas-flowering-plants — Boyle 1945

n 91×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Reeder 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type744 records

Wild obs. + sensor45

Museum / vouchered699

Origin

Native8

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 19≤1 km 1

20 georeferenced · 25 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 74≤1 km 211≤10 km 94>10 km 9

388 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence699

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow, US	84
Bronx, US	83
Boise, US	53
Caldwell, US	52
Corvallis, US	50
Davis, US	48
Pocatello, US	44
Claremont, US	24
Arcata, US	22
Missoula, US	20
Angwin, US	18
Victoria, CA	18
Provo, US	16
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	14
Riverside, US	14
Ashland, US	10
Fredericton Stock Culture Collectionlocation not on record	7
Vancouver, CA	6
CASlocation not on record	5
Canadian Department of Agriculturelocation not on record	4
Wuzhou, CN	4
Los Angeles, US	4
San Diego, US	4
Bozeman, US	4
VALElocation not on record	3
San Jose, US	3
University of Stellenboschlocation not on record	3
US	3
Istituto Agrario Castelnuovolocation not on record	2
University of Alberta Museumslocation not on record	2
Santa Cruz, US	2
DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Bend, US	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Bloomington, US	1
INFlocation not on record	1
BClocation not on record	1
KNFSClocation not on record	1
St. Paul, US	1
Bureau of Land Management, Medford District Officelocation not on record	1
Santa Barbara, US	1
Kew, GB	1
Tacoma, US	1
Albuquerque, US	1
Research Collection of B. A. Bennettlocation not on record	1
San Luis Obispo, US	1

47 institutions · 645 of 699 vouchered records shown · 54 without an institution code

09Environmental DNA3 detections

Where the DNA of Melica bulbosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.70 °C 9.70–9.70

Seasonal swing summer↔winter23.9 °C

Max temp (day)15.5 °C

Min temp (night)3.10 °C

Precipitation127 mm/mo

Air humidity54.4 %

Moisture balance3.50 mm/mo

Vapour deficit553 Pa

Wind speed2.70 m/s

Cloud cover38.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)