Melica amethystina

Pourr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Melica

At a glance

Occurrence records1 809

Data sources7

Biological traits15

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Melica amethystina's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 809 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF1 809 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Melica amethystina is a grass species in the family Poaceae that can be found in southern Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.16 m

Seed mass1.3 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanHP

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)379 mg/g

Specific leaf area (SLA)19.98 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melica amethystina has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPZ098314.1 ↗134 506 bpFrance · 1930

ACGT

ATACCCAATATCTTGCTGAAACAAGATATTGGGTATTTCTGGCTTTCCTTTCTTCAAAAAATCCTATATGTTAAGAAAGAAACCTTATCC …

Melica amethystina voucher US:3987486 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Melica amethystina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 366×CCDB · iber-fl · CCDB · book-ipcn75-78 · CCDB · book-fedorov +1

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · book-ipcn75-78 — Na tarajan 1977

CCDB · book-ipcn75-78 — Natarajan 1978

CCDB · book-fedorov — Doulat 1943

CCDB · book-fedorov — Tateoka 1960b

CCDB · book-atlas-flowering-plants — Doulat, D. 1951

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 809 records

Wild obs. + sensor1 776

Museum / vouchered33

Range

Area of Occupancy AOO2 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy22% within 1 km

≤100 m 198≤1 km 174≤10 km 1 322>10 km 16

1 710 georeferenced · 66 without coordinates

Open the mapobservation + sensor1 776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤1 km 4≤10 km 7

11 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	19
JBSlocation not on record	2
Paris, FR	1
Uniwersytet Śląski w Katowicachlocation not on record	1
València, ES	1

5 institutions · 24 of 33 vouchered records shown · 9 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melica amethystina

At a glance

Sources7 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 809 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 5 geolocated

Record type1 809 records