Melia azedarach
speciesAt a glance
Occurrence records53 599
Data sources17
Biological traits152
DNA specimens143
eDNA detections79
Sources17 archives
Databases and archives Melia azedarach's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility53 573 records↗
OBISOcean Biodiversity Information System26 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics143 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources152 traits
Chemical compositionLOTUS · NPASS651 compounds
Occurrence & distributionGBIF · OBIS53 599 records
Environmental DNA1 datasets · 10 countries79 detections
DNA & barcodingBOLD · NCBI143 specimens
Genome at a glanceCCDB · GIFT · GoaT455 Mbp
01Narrative
Melia dubia est une espèce d'arbres à feuillage caduc de la famille des Meliaceae originaire du sud de l'Asie et d'Australie. C'est un arbre à la croissance très rapide. Il est cultivé pour la production de biomasse et de bois énergie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology29
Fruit length15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 16 mm
Fruit width10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 12 mm
Fruit width max15 mm
Fruit width min6 mm
Inflorescence length max25 cm
Inflorescence length min20 cm
Leaf length65 mm
Leaf length max800 mm
Leaf length min25 mm
Leaf mass48.3 mg
Leaf mass per area49.07 g/m2
Leaf size895 mm²
Leaf width17.5 mm
Leaf width max300 mm
Leaf width min10 mm
Petiole length11.5 cm
Plant height12 m
⚠ sources differ — GIFT: 12 m · AusTraits: 27.5 m · USDA: 15.24 m · TRY: 14.4 m
Plant height max40 m
Plant height min1 m
Seed length6 mm
Seed length max3.5 mm
Seed mass391 mg
⚠ sources differ — TRY: 391 mg · AusTraits: 190 mg · GIFT: 373 mg
Seed mass max1 209 mg
Seed mass min14 mg
Seed volume760 mm³
Seed volume max760 mm³
Seed volume min760 mm³
Seed width4.5 mm
Seed width max1.6 mm
Life cycle & reproduction36
Bloom periodIndeterminate
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourpurple
Flower conspicuousYes
Flower width max3 mm
Flower width min2 mm
Flowering endMay
Flowering startApr
Flowering timennnnnnnnyyyn
Fruit seed period beginYear Round
Fruit seed period endYear Round
Growth rate USDARapid
Life formtree
Life spanperennial
Lifeform raunkiaer detailedphanerophyte
Lifespan categoryModerate
Lifespan years100 years
⚠ sources differ — TRY: 100 years · AusTraits: 85 years
Pollination syndromebee
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Reproductive maturity5 years
Resprout abilityYes
Resprouting capacityresprouts
Seed spread rateModerate
Sex typemonoecious
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment35
Active growth periodYear Round
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 400 m
Elevation mean600 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureFine
Fruit colourbrown
Fruit fleshinessfleshy
Fruit typedrupe
Growth formtree
Growth form USDASingle Stem
Habitat GIFTCaatinga (stricto sensu), Cerrado (lato sensu), Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)
Hedge toleranceMedium
Known allelopathYes
Leaf compoundnesscompound
Leaf formlanceolate
Leaf retentionYes
Leaf shapeelliptical lanceolate oblong ovate
Low growing grassNo
Mycorrhiza type0.000000536
Root depth min60 in
Shape and orientationIrregular
Small grainNo
Succulenceno
Woodinesswoody
Physiology & chemistry26
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min365 days
Leaf C:N ratio14.2 g/g
Leaf c461 mg/g
Leaf dry-matter content (LDMC)339 mg/g
Leaf n33.26 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min20 in
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8 pH
Soil pH min4 pH
Specific leaf area (SLA)13.09 mm²/mg
Temperature min17 °F
Wood density436 mg/cm³
⚠ sources differ — TRY: 436 mg/cm³ · GIFT: 496 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicitySlight
Veneer productNo
Other traits10
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr15.24 m
Inflorescencepanicle
Leaf arrangementalternate
Planting density max300 per acre
Planting density min150 per acre
Shoot orientationerect
03Chemical composition651 compounds
Compounds documented for Melia azedarach across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Limonoids282
Lanostane, Tirucallane and Euphane triterpenoids65
Lanostane, Tirucallane and Euphane triterpenoids $ Limonoids39
Stigmastane steroids20
Cinnamic acids and derivatives15
Documented compounds651 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | NPASS | |
| (+)-alpha-Muurolene | present | NPASS | |
| (+)-Pinoresinol | present | LOTUS | |
| (+)-pulegone | present | NPASS | |
| (+)-Ursolic Acid | present | LOTUS | |
| (-)-alpha-Curcumene | present | NPASS | |
| (10E,12E,14R)-14-hydroxy-9-oxooctadeca-10,12-dienoic acid | present | LOTUS | |
| (13alpha,17alpha)-7alpha-Acetoxy-21,23-epoxy-4,4,8-trimethyl-24-nor-5alpha-chola-1,14,20,22-tetren-3-one | present | LOTUS | |
| (1R)-1-[(2R,4R,5R)-5-hydroxy-4-[(3S,5R,9S,10R,13S,14S,17S)-3-hydroxy-4,4,10,13,14-pentamethyl-2,3,5,6,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]oxolan-2-yl]-2-methylpropane-1,2-diol | present | LOTUS | |
| (1R,2R,4S,7R,8S,11R,12S,17R)-7-(furan-3-yl)-1,12,16,16-tetramethyl-3,6-dioxapentacyclo[9.8.0.02,4.02,8.012,17]nonadec-13-ene-5,15,19-trione | present | LOTUS |
05DNA & barcoding143 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melia azedarach has left across the world's sequence archives.
At a glance
DNA specimens143
Marker genes8
GenBank sequences10
eDNA detections79
Countries10
The DNA barcodea real sequence read deposited for this species
TCGACTCTCCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGA …
Melia azedarach voucher MD002_4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL4★rbcLa★trnL★ITS3★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Melia azedarach carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size454 770 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Melia azedarach0.45 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records28–282n range28median28mode16records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2816×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · book-ipcn66 +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Chromosome numbers of some flowering plants of Spain and France. Gadella, Th., E. Kliphuis & E. A. Mennega.Acta Bot. Neerl.15(2): 484-489(1966).
CCDB · book-ipcn66 — Gadella et al. 1966
CCDB · book-ipcn67-71 — Q22 STYLES, B.T., & C.G. VOSA. 1971. Chromosome numbers in the Meliaceae. Taxon 20: Q85-Q99.
CCDB · book-indian_vol1 — Bowden, W.M. 1945a ; Minfray, E. 1963 ; Styles, B.T. & Vosa, e.G. 1971 ; Mebra, P.N. et al. 1972 ; Datta, P.e. & Samanta, P. 1977
CCDB · book-indian_vol1 — Mehra, P.N. & Khosla, P.K. 1969 ; Mehra P.N. 1972 ; Mehra, P.N., Sareen, T.S. & Khosla, P .K. 1972
CCDB · book-indian_vol1 — Mehra, P.N., Sareen, T.S. & Khosla, P.K. 1972 ; Minfray, E. 1963
CCDB · book-atlas-flowering-plants — Bowden 1945a
CCDB · kew — Ohri D. (pers. comm. 2002).
CCDB · Cave1963 — Minfray 1963b
CCDB · CromoCat 2015 — Gadella, Th. W. J., Kliphuis, E. & Mennega, E. A. (1966). Chromosome numbers of some flowering plants of Spain and S France. Acta Bot. Neerl. 15(2): 484-489.
GIFT · GIFT (floras)
n 1411×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +2
CCDB · ipcn-api-dl — Singhal, V. K. & B. S. Gill. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 115–117.
CCDB · ipcn-api-dl — Sandhu, P. S. & S. K. Mann. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.
CCDB · book-ipcn72 — MEHRA, P.N . T.S. SAREEN, & P.K. KHOSLA. 1972. Cytological studies on Himalayan Meliaceae. J. Arnold Arbor. 53: 558-568.
CCDB · book-ipcn72 — MEHRA, P.N. 1972. Cytogenetical evolution of hardwoods. Nucleus 15: 64-83.
CCDB · book-ipcn67-71 — MEHRA, P.N., & P.K. KHOSLA. 1969. In IOPB chromosome number reports XX. Taxon 18: 213-221.
CCDB · book-ipcn75-78 — Mehra 1976
CCDB · CromoCat 2015 — Sandhu, P. S. & S. K. Mann. (1988). SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219-228.
CCDB · CromoCat 2015 — Singhal, V.K. & B.S. Gill. (1984). SOCGI plant chromosome number reports -- II. Journal of Cytology and Genetics 19: 115-117
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=0.989 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type53 599 records
Wild obs. + sensor47 477
Museum / vouchered5 452
Cultivated / captive13
Other657
Origin
Native177
Introduced2 057
Range
Area of Occupancy AOO99 952 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 27 174≤1 km 4 011≤10 km 2 530>10 km 1 074
34 789 georeferenced · 12 688 without coordinates
Open the mapobservation + sensor47 477
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 539≤1 km 317≤10 km 569>10 km 151
1 576 georeferenced · 3 876 without coordinates
Open the institutions mapphysical evidence5 452
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy67% within 1 km
≤100 m 2≤1 km 2≤10 km 2
6 georeferenced · 7 without coordinates
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions227 of 472 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 236 |
| Durango, MX | 191 |
| Brisbane, AU | 156 |
| Saint Louis, US | 147 |
| Nanjing, CN | 115 |
| Museo Entomologico de Leonlocation not on record | 114 |
| Bronx, US | 103 |
| Guangzhou, CN | 95 |
| Canberra, AU | 95 |
| Zhengzhou, CN | 91 |
| Smithfield, AU | 87 |
| Tampa, US | 76 |
| Odawara, JP | 74 |
| Austin, US | 73 |
| Mexico City, MX | 72 |
| Pretoria, ZA | 69 |
| Central China Normal Universitylocation not on record | 68 |
| Fort Worth, US | 62 |
| Kunming, CN | 60 |
| Guilin, CN | 57 |
| BAYLUlocation not on record | 56 |
| Palmerston, AU | 53 |
| Mount Annan, AU | 53 |
| Kensington, AU | 46 |
| Kew, GB | 46 |
| National Museum of Natural Sciencelocation not on record | 46 |
| Mexico City, MX | 43 |
| Wuhan, CN | 41 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 41 |
| Nishihara, JP | 38 |
| Durban, ZA | 37 |
| Auckland, NZ | 37 |
| Kochi, JP | 35 |
| TAIElocation not on record | 35 |
| Riverside, US | 33 |
| Baroda, IN | 31 |
| Chicago, US | 30 |
| Bangkok, TH | 30 |
| Mérida, MX | 29 |
| University of Stellenboschlocation not on record | 27 |
| Chapingo, MX | 27 |
| Adelaide, AU | 27 |
| Tsukuba, JP | 26 |
| Chapel Hill, US | 26 |
| UTFPR-CPlocation not on record | 25 |
| Yangling, CN | 25 |
| Ivano-Frankivsk, UA | 24 |
| MeiseBGlocation not on record | 24 |
| Denton, US | 24 |
| Taipei, TW | 24 |
| Puerto Ayora, EC | 23 |
| Claremont, US | 23 |
| US | 22 |
| Shanghai, CN | 22 |
| Armidale, AU | 22 |
| Jena Microbial Resource Collectionlocation not on record | 21 |
| Jackson, US | 20 |
| San Diego, US | 20 |
| ASUlocation not on record | 20 |
| Chiba, JP | 20 |
| Nagano City, JP | 20 |
| Universidad Nacional de Colombia (UNAL)location not on record | 19 |
| Taipei, TW | 18 |
| Tokushima, JP | 18 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 18 |
| Sanda, JP | 17 |
| Campo Mourão, BR | 17 |
| Kagoshima, JP | 17 |
| Miami, US | 17 |
| Texas Lutheran Universitylocation not on record | 17 |
| NSMKlocation not on record | 17 |
| Adam Mickiewicz University in Poznańlocation not on record | 16 |
| JBRJlocation not on record | 16 |
| BIO-UNIPIlocation not on record | 16 |
| Chongqing Museumlocation not on record | 15 |
| Paris, FR | 15 |
| Williamsburg, US | 15 |
| Tuscaloosa, US | 14 |
| Blumenau, BR | 13 |
| Universidad de Antioquia (UdeA)location not on record | 13 |
| Bloomington, US | 13 |
| Université de Strasbourglocation not on record | 13 |
| Guiyang, CN | 13 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 12 |
| Hunan Hupingshan National Nature Reservelocation not on record | 12 |
| Berlin, DE | 12 |
| Hangzhou, CN | 12 |
| Cape Town, ZA | 12 |
| GAlocation not on record | 12 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 12 |
| Barcelona, ES | 12 |
| University of North Carolina at Pembrokelocation not on record | 11 |
| Universidad Industrial de Santander (UIS)location not on record | 11 |
| Valdosta State Universitylocation not on record | 11 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 11 |
| UFBAlocation not on record | 11 |
| Nishihara, JP | 11 |
| Columbia, US | 11 |
| Istituto Agrario Castelnuovolocation not on record | 11 |
| MAlocation not on record | 11 |
| Nagasaki University - Fisherieslocation not on record | 10 |
| Wuzhou, CN | 10 |
| Rotorua, NZ | 10 |
| BISHlocation not on record | 10 |
| Córdoba, AR | 10 |
| Toyama, JP | 10 |
| Guangzhou, CN | 10 |
| Flagstaff, US | 10 |
| UNIVASFlocation not on record | 10 |
| CASlocation not on record | 9 |
| Norfolk, US | 9 |
| Juriquilla, MX | 9 |
| National Biodiversity Institute, Costa Ricalocation not on record | 9 |
| UEMlocation not on record | 9 |
| Maringá, BR | 9 |
| Tuxtla Gutiérrez, MX | 9 |
| Fayetteville, US | 9 |
| Chengdu, CN | 9 |
| Strecker Museum, Baylor Universitylocation not on record | 9 |
| Antiguo Cuscatlán, SV | 9 |
| Honolulu, US | 9 |
| Tapachula, MX | 9 |
| AUAlocation not on record | 9 |
| Pondicherry, IN | 9 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 9 |
| Mexico City, MX | 9 |
| Sagamihara, JP | 8 |
| PUC-RSlocation not on record | 8 |
| Xiamen, CN | 8 |
| University of Southern Mississippilocation not on record | 8 |
| Xian, CN | 8 |
| TAFORI-LSRClocation not on record | 8 |
| Criciúma, BR | 8 |
| XAJDlocation not on record | 8 |
| Salvador, BR | 8 |
| Cascavel, BR | 8 |
| Corrientes, AR | 8 |
| València, ES | 8 |
| UNESClocation not on record | 8 |
| Changsha, CN | 8 |
| lbglocation not on record | 8 |
| Hobart, AU | 7 |
| San Francisco, US | 7 |
| Mississippi State, US | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Forestry and Forest Products Research Institutelocation not on record | 7 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 7 |
| James Cook Townsvillelocation not on record | 7 |
| Ciudad de México, MX | 7 |
| UNICAMPlocation not on record | 7 |
| FFPRIlocation not on record | 7 |
| Zhejiang Museum of Natural Historylocation not on record | 7 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 7 |
| EL PASO, US | 6 |
| Phoenix, US | 6 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 6 |
| UnBlocation not on record | 6 |
| BDBClocation not on record | 6 |
| Wlocation not on record | 6 |
| Nanyue Arboretumlocation not on record | 6 |
| Northridge, US | 6 |
| Cambridge, US | 6 |
| Lubbock, US | 6 |
| Xinxiang, CN | 6 |
| Christchurch, NZ | 6 |
| Universidad de La Salle (La Salle)location not on record | 6 |
| USP-IBlocation not on record | 6 |
| Loja, EC | 6 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| KOMlocation not on record | 6 |
| GZUlocation not on record | 6 |
| Cenargenlocation not on record | 5 |
| HUT Culture Collectionlocation not on record | 5 |
| Tlalnepantla, MX | 5 |
| St. Augustine, TT | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| SSNHlocation not on record | 5 |
| Lake Charles, US | 5 |
| Bogotá, D.C., CO | 5 |
| Chaguaramas, TT | 5 |
| BClocation not on record | 5 |
| South China Normal Universitylocation not on record | 5 |
| Altos de Pipe, VE | 5 |
| Instituto de Investigação Científica Tropicallocation not on record | 5 |
| WNNUlocation not on record | 5 |
| Brasília, BR | 5 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 5 |
| 盐城国家级珍禽自然保护区location not on record | 5 |
| Santa Barbara, US | 5 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 5 |
| LDlocation not on record | 5 |
| Cusco, PE | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Vitoria, ES | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| HNBlocation not on record | 5 |
| Laboratorio de Ictiologialocation not on record | 4 |
| Wellington, NZ | 4 |
| CJBGlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 4 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 4 |
| San Francisco de Campeche, MX | 4 |
| Clemson, US | 4 |
| Seoul, KR | 4 |
| San José, CR | 4 |
| Lima, PE | 4 |
| Mérida, MX | 4 |
| South Kensington, GB | 4 |
| Kawasaki Shi Tama Ku, JP | 4 |
| ESALQlocation not on record | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| Zürich, CH | 4 |
| Fredericksburg, US | 4 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Long Beach, US | 4 |
| 黔东南州民族医药研究所标本室location not on record | 4 |
| Universiti Sains Malaysialocation not on record | 4 |
| Wuhan, CN | 4 |
| Anhui Normal Universitylocation not on record | 4 |
| Herbarium of South China Botanical Gardenlocation not on record | 4 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Valparaiso, CL | 4 |
| Edmonton, CA | 4 |
| Logan, US | 4 |
| Albuquerque, US | 4 |
| Stockholm, SE | 4 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Universidade de São Paulolocation not on record | 4 |
| Davis, US | 3 |
| Sendai, JP | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| UFSCarlocation not on record | 3 |
| Guatemala City, GT | 3 |
| FJIDClocation not on record | 3 |
| KURAlocation not on record | 3 |
| CEPLAClocation not on record | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Masindi, UG | 3 |
| Sri Ramaswamy Memorial Universitylocation not on record | 3 |
| Edinburgh, GB | 3 |
| Londrina, BR | 3 |
| BGPAlocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Philadelphia, US | 3 |
| China Agricultural Universitylocation not on record | 3 |
| Osaka, JP | 3 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 3 |
| Salamanca, ES | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Wollongong, AU | 3 |
| Lanzhou, CN | 3 |
| Lincoln, US | 3 |
| Jinghong, CN | 3 |
| Tomioka, JP | 3 |
| UFVJMlocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| Brasília, BR | 3 |
| Shanghai, CN | 3 |
| Central China Agricultural Universitylocation not on record | 3 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 3 |
| Stephenville, US | 3 |
| CICYTEXlocation not on record | 3 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 3 |
| Uberlândia, BR | 3 |
| Guasave, MX | 3 |
| Pullman, US | 3 |
| College Park, US | 3 |
| Ishikawa Museum of Natural Historylocation not on record | 3 |
| HAWlocation not on record | 3 |
| Iquitos, PE | 3 |
| León, NI | 3 |
| Autlán de Navarro, MX | 3 |
| Badajoz, ES | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| MEXUlocation not on record | 3 |
| FUNEDlocation not on record | 3 |
| Bando, JP | 3 |
| Knoxville, US | 3 |
| Provo, US | 2 |
| Qufu Normal Universitylocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Görlitz, DE | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Mexico City, MX | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Little Rock, US | 2 |
| Conway, US | 2 |
| UEPAlocation not on record | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| Puebla, MX | 2 |
| SCAUlocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Moscow, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| HUAlocation not on record | 2 |
| Plocation not on record | 2 |
| UFPElocation not on record | 2 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 2 |
| Port Elizabeth Museum (Bayworld)location not on record | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| UFPRlocation not on record | 2 |
| Zhuzhou, CN | 2 |
| UFERSAlocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| Cuiabá, BR | 2 |
| Beijing, CN | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| FUVATESlocation not on record | 2 |
| QAUlocation not on record | 2 |
| Orem, US | 2 |
| UTFPR-DVlocation not on record | 2 |
| Chengdu, CN | 2 |
| Hermosillo, MX | 2 |
| Guizhou Forestry Schoollocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| San Bernardino, US | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 2 |
| UFOPlocation not on record | 2 |
| Centro de Ecologia Aplicada del Litoral (CECOAL-CONICET-UNNE)location not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Austin, US | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Guiyang, CN | 2 |
| University of Johannesburglocation not on record | 2 |
| UFSClocation not on record | 2 |
| Córdoba, ES | 2 |
| Fukushima Universitylocation not on record | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 2 |
| Guangxi Medicinal Botanic Gardenlocation not on record | 2 |
| CNF-UFHBlocation not on record | 2 |
| La Paz, BO | 2 |
| KNAMlocation not on record | 2 |
| Xian, CN | 2 |
| Guiyang, CN | 2 |
| Weber State Universitylocation not on record | 2 |
| Ilhéus, BR | 2 |
| Alicante, ES | 2 |
| Burlington, US | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| SDFlocation not on record | 1 |
| FJFClocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Brisbane Botanic Gardens, Queensland Herbariumlocation not on record | 1 |
| Shenzhen, CN | 1 |
| ISAlocation not on record | 1 |
| San Jose, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Awka, NG | 1 |
| Bratislava, SK | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Montecillo, Texcoco, MX | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| Davenport, US | 1 |
| UFSJlocation not on record | 1 |
| LBVlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Nanjing, CN | 1 |
| Denver, US | 1 |
| Los Angeles, US | 1 |
| UNESP-IBILCElocation not on record | 1 |
| GMBAlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| QCNElocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| UPNlocation not on record | 1 |
| BMlocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| University of Bayreuthlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Oskarshamn, SE | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Quito, EC | 1 |
| Zacatecas, MX | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Arusha, TZ | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Linares, MX | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| SJNAlocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Tartu, EE | 1 |
| Alexandria Universitylocation not on record | 1 |
| US | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Arcata, US | 1 |
| Cruz das Almas, BR | 1 |
| Richmond, US | 1 |
| 武陵山动植物研究所location not on record | 1 |
| Nanjing, CN | 1 |
| ESP003location not on record | 1 |
| Addis Ababa, ET | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Cape Town, ZA | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Chicago, US | 1 |
| UFMGlocation not on record | 1 |
| GHPG$location not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| Yaoundé, CM | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| JP | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| EAlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Emporia, US | 1 |
| San Angelo, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| UChlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| UFESlocation not on record | 1 |
| Hiratsuka City Museumlocation not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| Cambridge, US | 1 |
| Batemans Bay, AU | 1 |
| Herbarium of the Kyushu University Museum (FU)location not on record | 1 |
| Cincinnati, US | 1 |
| IPA/SPlocation not on record | 1 |
| Due West, US | 1 |
| KIRMlocation not on record | 1 |
| Madison, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| UNESP-ISlocation not on record | 1 |
| Salta, AR | 1 |
| Angwin, US | 1 |
| GJOlocation not on record | 1 |
| Washington, US | 1 |
| UIBlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Southwest Forestry Collegelocation not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
472 institutions · 5 102 of 5 452 vouchered records shown · 323 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA79 detections
Where the DNA of Melia azedarach was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found79
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 79 detections have coordinates
Open the map10 countries0
Hills and ridgesGrass along roadsides
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.1 °C 15.7–25.1
Seasonal swing summer↔winter11.6 °C
Max temp (day)24.5 °C 19.6–29.9
Min temp (night)16.9 °C 10.1–22.4
Precipitation130 mm/mo 22.2–328
Air humidity58.2 % 51.0–66.5
Moisture balance-1.50 mm/mo
Vapour deficit965 Pa 720–1,616
Wind speed3.40 m/s
Cloud cover28.5 % 13.0–52.9
CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.