Melhania ovata

(Cav.) Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Melhania

At a glance

Occurrence records225

Data sources7

Biological traits14

DNA specimens14

eDNA detections6

Sources7 archives

Databases and archives Melhania ovata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility225 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources14 traits

Occurrence & distributionGBIF225 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI14 specimens

01Narrative

Melhania ovata is a plant in the family Malvaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology3

Seed mass3.47 mg

Seed mass max3.47 mg

Seed mass min3.47 mg

Life cycle & reproduction5

Dispersal typewind

Life formannual or subshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formchamaephyte

Habitat & environment5

Climatedesert or dry shrubland

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub subshrub

Habitat GIFTcommon in roadsides in dry grassland

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melhania ovata has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes5

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKR733686.1 ↗380 bpKenya · 2013

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCTAGCAGAATGACCCGCGAACAAGTTCAAAACACCAAGGGGTTGCGA …

Melhania ovata 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★rbcLa★trnL-F★ITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type225 records

Wild obs. + sensor28

Museum / vouchered182

Other15

Origin

Native2

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 3

4 georeferenced · 24 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 18≤1 km 12≤10 km 22>10 km 11

63 georeferenced · 119 without coordinates

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	46
Brisbane, AU	36
Kew, GB	18
Canberra, AU	7
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	6
James Cook Townsvillelocation not on record	6
Saint Louis, US	5
University of Stellenboschlocation not on record	4
MeiseBGlocation not on record	3
Paris, FR	3
Xiamen, CN	3
Uniwersytet Śląski w Katowicachlocation not on record	3
Palmerston, AU	2
Berlin, DE	2
Museo Entomologico de Leonlocation not on record	2
Uppsala, SE	2
South Kensington, GB	2
Edinburgh, GB	2
Stockholm, SE	1
Pondicherry, IN	1
Bronx, US	1
LDlocation not on record	1
University of Alberta Museumslocation not on record	1
Smithfield, AU	1
TAFORI-LSRClocation not on record	1
MAlocation not on record	1

26 institutions · 160 of 182 vouchered records shown · 22 without an institution code

09Environmental DNA6 detections

Where the DNA of Melhania ovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

STRI plot

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 18.2–20.1

Seasonal swing summer↔winter2.60 °C

Max temp (day)23.2 °C 23.2–25.5

Min temp (night)13.2 °C 13.2–14.6

Precipitation55.0 mm/mo 55.0–138

Air humidity57.3 % 57.3–58.2

Moisture balance-66.0 mm/mo -66.0–-2.80

Vapour deficit897 Pa 897–984

Wind speed2.40 m/s 2.40–2.70

Cloud cover38.8 % 38.8–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)