Melastoma denticulatum

Labill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Melastomataceae/Melastoma

At a glance

Occurrence records97

Data sources4

Biological traits9

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Melastoma denticulatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility97 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF97 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction2

Dispersal typeanimal

Life spanperennial

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Succulenceno

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melastoma denticulatum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSJQ730104.1 ↗935 bp

ACGT

TAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAAACGAACGGAAGAACGACCCGCGAACC …

Melastoma denticulatum voucher Simmons, M. P., 1842 (BH) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type97 records

Wild obs. + sensor33

Museum / vouchered64

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 8≤1 km 2≤10 km 5

15 georeferenced · 18 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤1 km 4≤10 km 12

18 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Université de Strasbourglocation not on record	17
Paris, FR	12
Auckland, NZ	8
Zürich, CH	7
Bronx, US	4
Wellington, NZ	3
University of Stellenboschlocation not on record	2
Wlocation not on record	2
Honolulu, US	2
Saint Louis, US	2
Gump Stationlocation not on record	1
Bloomington, US	1
Monastir, TN	1
Canberra, AU	1

14 institutions · 63 of 64 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)