Melanothamnus harveyi

(Bailey) Diaz-Tapia & Maggs · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Rhodomelaceae/Melanothamnus

At a glance

Occurrence records1 734

Data sources8

Biological traits1

DNA specimens183

eDNA detections93

Sources8 archives

Databases and archives Melanothamnus harveyi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility560 records↗

OBISOcean Biodiversity Information System1 174 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI93 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics183 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS1 734 records

Environmental DNA5 datasets · 8 countries93 detections

DNA & barcodingBOLD183 specimens

Genome at a glanceGoaT1 Gbp

01Narrative

Melanothamnus harveyi (Polysiphonia harveyi), Harvey's siphon weed,Bunker, F.StP. D., Brodie, J.A., Maggs, C. and Bunker, A.R. 2017. Seaweeds of Britain and Ireland. Second Edition, Wild Nature Press, Plymouth, UK is a small marine red alga in the division of Rhodophyta.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding183 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melanothamnus harveyi has left across the world's sequence archives.

At a glance

DNA specimens183

BINs1

Marker genes7

eDNA detections93

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus94 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.07%

Haplotypes2

BIN1

Most divergent pair3.5%

AACTTTATATTTAATATTTGGAGCATTTTCAGGAGTGTTAGGAGGTTGTATGTCTATGCTAATTCGTATGGAATTAGCACAACCAGGTAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Melanothamnus japonicussame genus3.2%Melanothamnus maniticolasame genus11.6%Osmundea osmundasame family14.6%Laurencia distichophyllasame family15.5%Polysiphonia morrowiisame family15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL★ITS18S28S28S-D2PSBA

animal barcodeplant barcodefungal barcoderibosomalmarker

06Genome at a glanceGoaT

The complete instruction manual Melanothamnus harveyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 026 900 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Melanothamnus harveyi1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 641×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

08Occurrence & distribution

Record type1 734 records

Wild obs. + sensor475

Museum / vouchered1 188

Other71

Origin

Introduced4

Range

Area of Occupancy AOO1 468 km²

Depth

0–200 m sunlit158

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.2 m · max 22.9 m · 158 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 224≤1 km 34≤10 km 86

344 georeferenced · 131 without coordinates

Open the mapobservation + sensor475

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 41≤1 km 1≤10 km 4

46 georeferenced · 1 142 without coordinates

Open the institutions mapphysical evidence1 188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DASSHlocation not on record	20
PNHSlocation not on record	17
University of New Brunswick, Frederictonlocation not on record	14
University of New Brunswick, Centre for Environmental & Molecular Algal Researchlocation not on record	8
University of Stellenboschlocation not on record	5
UAclocation not on record	4
Institut Francais pour l'Etude de la Merlocation not on record	4
KMNlocation not on record	4
Ann Arbor, US	2
nbflocation not on record	1
486location not on record	1
Stockholm, SE	1
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	1
Gotland Universitylocation not on record	1
Marine Biological Association of the UKlocation not on record	1

15 institutions · 84 of 1 188 vouchered records shown · 123 without an institution code

09Environmental DNA93 detections

Where the DNA of Melanothamnus harveyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found93

Studies independent surveys5

Countries8

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 93 detections have coordinates

Open the map8 countries0

Marina wall

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.3 °C 3.10–16.7

Seasonal swing summer↔winter22.0 °C

Max temp (day)12.7 °C 5.70–20.1

Min temp (night)8.00 °C 0.9–14.9

Precipitation129 mm/mo 79.9–151

Air humidity61.3 % 59.7–65.2

Moisture balance46.3 mm/mo -37.5–92.2

Vapour deficit481 Pa 289–733

Wind speed5.40 m/s 3.00–7.30

Cloud cover49.6 % 38.3–59.9

CHELSA 1981–2010, ~9 km grid, at location & month of 82 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melanothamnus harveyi

At a glance

Sources8 archives

Habitat & environment1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 734 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 734 records