Melanolepis multiglandulosa

(Reinw. ex Blume) Rchb. & Zoll. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Melanolepis

At a glance

Occurrence records3 749

Data sources9

Biological traits32

DNA specimens18

eDNA detections13

Sources9 archives

Databases and archives Melanolepis multiglandulosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 749 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Occurrence & distributionGBIF3 749 records

Environmental DNA1 datasets · 3 countries13 detections

DNA & barcodingBOLD · NCBI18 specimens

01Narrative

Melanolepsis multiglandulosa is a plant species of the family Euphorbiaceae, first described in 1826.Zollinger, Heinrich. 1856. Acta Societatis Regiae Scientiarum Indo-Neerlandicae 1(4): 22.Reichenbach, Heinrich Gustav & Zollinger, Heinrich. 1857. Linnaea 28: 324-325 in LatinTropicos It is native to Nansei-shoto, Mariana Islands, Solomon Islands, Bismarck Archipelago, New Guinea, Maluku, Sulawesi, Philippines, Lesser Sunda Islands, Java, Sumatra, Borneo, Thailand, Malaysia and Taiwan.Kew World Checklist of Selected Plant FamiliesGovaerts, R., Frodin, D.G. & Radcliffe-Smith, A. (2000). World Checklist and Bibliography of Euphorbiaceae (and Pandaceae) 1-4: 1-1622. The Board of Trustees of the Royal Botanic Gardens, Kew.Flora of China Vol. 11 Page 240 墨鳞 mo lin Melanolepis multiglandulosa (Reinwardt ex Blume) H. G. Reichenbach & Zollinger, Acta Soc. Regiae Sci. Indo-Neêrl. 1(4): 22. 1856., Croton multiglandulosus Reinwardt ex Blume, Catalogus, 105. 1823; Mallotus multiglandulosus (Reinwardt ex Blume) Hurusawa

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology16

Fruit length6.5 mm

Fruit length max7 mm

Fruit length min6 mm

Fruit width9 mm

Fruit width max10 mm

Fruit width min8 mm

Inflorescence length max40 cm

Inflorescence length min5 cm

Leaf length215 mm

Leaf length max350 mm

Leaf length min80 mm

Leaf width215 mm

Leaf width max350 mm

Leaf width min80 mm

Plant height max12 m

Seed mass35.88 mg

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max400 m

Elevation mean250 m

Elevation min100 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density391 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melanolepis multiglandulosa has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes3

GenBank sequences10

eDNA detections13

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLJF739159.1 ↗526 bpPapua New Guinea · 2007

ACGT

GATTATAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT …

Melanolepis multiglandulosa voucher WS5D0800 ribulose-1,5-bisphophate carboxylase oxygenase (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8trnH-psbA

plant barcodemarker

07Deep time~19 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin19 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type3 749 records

Wild obs. + sensor2 896

Museum / vouchered769

Other84

Origin

Native23

Range

Area of Occupancy AOO5 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 609≤1 km 202≤10 km 67>10 km 56

1 934 georeferenced · 962 without coordinates

Open the mapobservation + sensor2 896

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 10≤1 km 2≤10 km 7>10 km 3

22 georeferenced · 747 without coordinates

Open the institutions mapphysical evidence769

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nishihara, JP	116
Taipei, TW	33
National Museum of Natural Sciencelocation not on record	32
TAIElocation not on record	23
Kew, GB	20
Taipei, TW	16
University of Stellenboschlocation not on record	16
Bronx, US	15
Saint Louis, US	13
Odawara, JP	11
Tsukuba, JP	9
Fort Worth, US	8
Beijing, CN	8
St. Paul, US	8
Taipei, TW	7
BISHlocation not on record	7
Llocation not on record	6
Nishihara, JP	6
Cibinong Science Center, Herbarium Bogorienselocation not on record	6
Nagano City, JP	5
Honolulu, US	5
Uniwersytet Wrocławskilocation not on record	5
MeiseBGlocation not on record	4
CASlocation not on record	4
Claremont, US	4
Kunming, CN	2
BMlocation not on record	2
Philadelphia, US	2
EL PASO, US	2
Austin, US	2
Cambridge University Herbariumlocation not on record	1
Forestry and Forest Products Research Institutelocation not on record	1
South Kensington, GB	1
Ann Arbor, US	1

34 institutions · 401 of 769 vouchered records shown · 365 without an institution code

09Environmental DNA13 detections

Where the DNA of Melanolepis multiglandulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 22.8–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 25.2–29.5

Min temp (night)22.6 °C 20.7–22.6

Precipitation269 mm/mo 262–341

Air humidity68.1 % 67.8–74.2

Moisture balance133 mm/mo 123–252

Vapour deficit1,080 Pa 715–1,080

Wind speed1.20 m/s 1.20–2.40

Cloud cover57.6 % 49.9–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melanolepis multiglandulosa

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction3

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

At a glance

When this lineage existed

Record type3 749 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 749 records