Melaleuca viridiflora

Sol. ex Gaertn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records9 778

Data sources12

Biological traits44

DNA specimens12

eDNA detections9

Sources12 archives

Databases and archives Melaleuca viridiflora's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 778 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Chemical compositionLOTUS · NPASS4 compounds

Occurrence & distributionGBIF9 778 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Distribution map Melaleuca viridiflora, commonly known as broad-leaved paperbark, is a plant in the myrtle family Myrtaceae, and is native to woodlands, swamps and streams in monsoonal areas of northern Australia and New Guinea. It is usually a small tree with an open canopy, papery bark and spikes of cream, yellow, green or red flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length4.5 mm

Fruit width4.5 mm

Leaf length170 mm

Leaf mass per area163 g/m2

Leaf size2 827 mm²

Leaf width37.5 mm

Petiole length1.15 cm

Plant height20 m

⚠ sources differ — GIFT: 20 m · AusTraits: 10 m · TRY: 3.1 m

Plant height max20 m

Plant height min2.5 m

Seed length1 mm

Seed mass0.25 mg

Seed mass max0.47 mg

Seed mass min0.04 mg

Seed width1 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timeyyyyyyyynnnn

Life formtree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry8

Leaf c530 mg/g

Leaf dry-matter content (LDMC)624 mg/g

Leaf n7.49 mg/g

Leaf p0.355 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)4.22 mm²/mg

Wood density823 mg/cm³

03Chemical composition4 compounds

Compounds documented for Melaleuca viridiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Monocyclic monoterpenoids2

Cinnamic acids and derivatives2

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-beta-Phellandrene	present	NPASS
(R)-alpha-Phellandrene	present	NPASS
2-Propenoic acid, 3-phenyl-, methyl ester	present	LOTUS
Methyl Cinnamate	present	LOTUS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca viridiflora has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes5

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMW139129.1 ↗312 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCATAACCATCTGGTGAGGGCACGTTTGCCTGGGTGTCACACATGGCGTTGCCCCG …

Melaleuca viridiflora isolate Mel-vir-b2-seq2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS6★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type9 778 records

Wild obs. + sensor5 423

Museum / vouchered2 645

Cultivated / captive13

Other1 697

Origin

Native196

Introduced1

Range

Area of Occupancy AOO20 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 3 238≤1 km 43≤10 km 30>10 km 23

3 334 georeferenced · 2 089 without coordinates

Open the mapobservation + sensor5 423

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 506≤1 km 324≤10 km 1 066>10 km 330

2 226 georeferenced · 419 without coordinates

Open the institutions mapphysical evidence2 645

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy71% within 1 km

≤1 km 5≤10 km 1>10 km 1

7 georeferenced · 6 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	802
Canberra, AU	566
Palmerston, AU	358
Smithfield, AU	195
Museo Entomologico de Leonlocation not on record	169
Mount Annan, AU	145
Kensington, AU	142
Adelaide, AU	44
Kew, GB	29
John T. Waterhouse Herbariumlocation not on record	20
Armidale, AU	18
Hobart, AU	11
James Cook Townsvillelocation not on record	9
University of Stellenboschlocation not on record	6
Honolulu, US	5
BISHlocation not on record	5
BGPAlocation not on record	4
Auckland, NZ	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Uppsala, SE	1
Istituto Agrario Castelnuovolocation not on record	1
Bronx, US	1
Saint Louis, US	1
MeiseBGlocation not on record	1
Rotorua, NZ	1
Parkville, AU	1
Beijing, CN	1
Catalina Island Conservancylocation not on record	1

28 institutions · 2 540 of 2 645 vouchered records shown · 101 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Melaleuca viridiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 18.3–26.2

Seasonal swing summer↔winter5.60 °C

Max temp (day)30.8 °C 23.2–31.6

Min temp (night)21.3 °C 13.4–22.7

Precipitation114 mm/mo 87.8–132

Air humidity58.2 % 53.3–62.0

Moisture balance-24.0 mm/mo -65.6–-2.50

Vapour deficit1,345 Pa 901–1,504

Wind speed2.70 m/s 2.60–3.60

Cloud cover51.2 % 40.8–71.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca viridiflora

At a glance

Sources12 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry8

Compound class profile2 classes

Documented compounds4 total

At a glance

Record type9 778 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 778 records