Melaleuca viminea

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records316

Data sources9

Biological traits32

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Melaleuca viminea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility316 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF316 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca viminea, commonly known as mohan is a plant in the myrtle family Myrtaceae and is endemic to the south-west of Western Australia. It is variable in size and form from a densely branched, small shrub to a small tree. It has become naturalised locally in southern Victoria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology10

Leaf length14 mm

Leaf width1.5 mm

Plant height3 m

Plant height max14 m

Plant height min0.5 m

Seed length0.9 mm

Seed mass0.179 mg

⚠ sources differ — AusTraits: 0.179 mg · GIFT: 0.165 mg

Seed mass max0.17 mg

Seed mass min0.16 mg

Seed width0.39 mm

Life cycle & reproduction9

Dispersal typeself

Flowering timennnnnnyyyyyn

Life formshrub

Life spanperennial

Pollination syndromebird+insect+mammal

Raunkiær life formphanerophyte

Reproductive maturity5 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition6 compounds

Compounds documented for Melaleuca viminea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Isoflavones2

Oleanane triterpenoids1

Lupane triterpenoids1

Ursane and Taraxastane triterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
Betulinic Acid	present	LOTUS
Daidzein	present	NPASS
Epoxydon	present	NPASS
Genistein	present	NPASS
Oleanolic acid	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca viminea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048881.1 ↗278 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATGGGGGCGATGGGCTTCGCCCAGCGTCCCCCGACGC …

Melaleuca viminea 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type316 records

Wild obs. + sensor103

Museum / vouchered211

Cultivated / captive2

Origin

Native11

Range

Area of Occupancy AOO960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 61≤1 km 32>10 km 3

96 georeferenced · 7 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 39≤1 km 5≤10 km 85>10 km 9

138 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence211

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	158
Adelaide, AU	13
Mount Annan, AU	11
BGPAlocation not on record	8
Brisbane, AU	7
Canberra, AU	5
Kew, GB	4
Claremont, US	1
Wellington, NZ	1
Phoenix, US	1
LDlocation not on record	1
Auckland, NZ	1

12 institutions · 211 of 211 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)