Melaleuca trichostachya

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records762

Data sources5

Biological traits36

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Melaleuca trichostachya's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility762 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF762 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca trichostachya is a plant in the myrtle family, Myrtaceae and is native to inland northern New South Wales, Queensland, South Australia and the Northern Territory in Australia. It is a small tree, similar to the commonly cultivated Melaleuca styphelioides, with its prickly foliage and fluffy spikes of white or cream flowers but there are differences in the leaf arrangement and fruiting capsules.Habit in the Severn River near Ballandean fruit

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit width3.5 mm

Leaf length20 mm

Leaf length max30 mm

Leaf length min10 mm

Leaf width1.75 mm

Leaf width max2.5 mm

Leaf width min1 mm

Petiole length0.1 cm

Plant height10 m

Plant height max10 m

Seed mass0.44 mg

Seed mass max0.84 mg

Seed mass min0.03 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeself

Flowering timeyynnnnnnnnny

Life formshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate linear

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca trichostachya has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF294602.1 ↗277 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAACGACCAGAGAACTAGTAACAAACTCGACGGGGGCGGTGGGCTCGCCCAACGTCCCCCGACGCT …

Melaleuca trichostachya 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type762 records

Wild obs. + sensor156

Museum / vouchered532

Cultivated / captive2

Other72

Origin

Native73

Introduced1

Range

Area of Occupancy AOO2 020 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 95≤1 km 9≤10 km 5>10 km 1

110 georeferenced · 46 without coordinates

Open the mapobservation + sensor156

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 110≤1 km 58≤10 km 219>10 km 103

490 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence532

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	230
Canberra, AU	88
Mount Annan, AU	70
Museo Entomologico de Leonlocation not on record	45
Smithfield, AU	33
Palmerston, AU	25
Adelaide, AU	18
Kew, GB	3
James Cook Townsvillelocation not on record	3
Armidale, AU	3
Northridge, US	2
Hobart, AU	2
Taipei, TW	1
John T. Waterhouse Herbariumlocation not on record	1
IPA/SPlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Rotorua, NZ	1

17 institutions · 527 of 532 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)