Melaleuca thymifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records3 396

Data sources10

Biological traits44

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Melaleuca thymifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF3 396 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca thymifolia, commonly known as thyme honey-myrtle, is a plant in the myrtle family Myrtaceae and is native to eastern Australia. It is often noticed in spring, with its attractive, purple flowers and is one of the most commonly cultivated melaleucas. A fragrant shrub, it usually grows to about 1.0 m tall, has corky bark and slender, wiry stems.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit width4 mm

Leaf length12.5 mm

Leaf length max15 mm

Leaf length min10 mm

Leaf width2 mm

Leaf width max3 mm

Leaf width min1 mm

Petiole length0.1 cm

Plant height1.5 m

Plant height max1 m

Seed length0.81 mm

Seed mass0.031 mg

⚠ sources differ — TRY: 0.031 mg · AusTraits: 0.036 mg · GIFT: 0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Seed width0.24 mm

Life cycle & reproduction9

Deciduousnessevergreen

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial

Lifespan years80 years

⚠ sources differ — TRY: 80 years · AusTraits: 60 years

Raunkiær life formphanerophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio50.56 g/g

Leaf c506 mg/g

Leaf n10 mg/g

Leaf p0.31 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.83 mm²/mg

Wood density608 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca thymifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048880.1 ↗277 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACCAGTAACAAACTCGATTGGGGCGGTGGGCTTGCCTAACGTCCCCCGACGCT …

Melaleuca thymifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Melaleuca thymifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Smith-White 1948a

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 396 records

Wild obs. + sensor2 728

Museum / vouchered582

Cultivated / captive10

Other76

Origin

Native217

Introduced7

Range

Area of Occupancy AOO6 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 2 178≤1 km 249≤10 km 67>10 km 40

2 534 georeferenced · 194 without coordinates

Open the mapobservation + sensor2 728

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 79≤1 km 89≤10 km 277>10 km 79

524 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence582

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 1

6 georeferenced · 4 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	222
Canberra, AU	111
Brisbane, AU	101
Museo Entomologico de Leonlocation not on record	58
Armidale, AU	27
Adelaide, AU	12
Wollongong, AU	12
NSW Dept of Planning, Industry and Environmentlocation not on record	7
Kew, GB	3
Rotorua, NZ	3
Batemans Bay, AU	2
Smithfield, AU	2
Kensington, AU	2
John T. Waterhouse Herbariumlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Auckland, NZ	1
IPA/SPlocation not on record	1
Riverside, US	1
Christchurch, NZ	1
Cape Town, ZA	1
Hobart, AU	1
Taipei, TW	1
La Trobe Universitylocation not on record	1

24 institutions · 575 of 582 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Melaleuca thymifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter8.90 °C

Max temp (day)24.2 °C

Min temp (night)18.2 °C

Precipitation94.2 mm/mo

Air humidity58.4 %

Moisture balance-80.4 mm/mo

Vapour deficit1,033 Pa

Wind speed5.20 m/s

Cloud cover19.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca thymifolia

At a glance

Sources10 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry8

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 396 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 396 records