Melaleuca styphelioides

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records5 383

Data sources11

Biological traits42

DNA specimens0

eDNA detections1

Sources11 archives

Databases and archives Melaleuca styphelioides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 383 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources42 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF5 383 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Melaleuca styphelioides, known as the prickly-leaved paperbark or prickly paperbark, is a plant native to eastern Australia. It is a tree with spongy bark, prickly leaves and spikes of creamy-white flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length2.75 mm

Fruit width2.5 mm

Leaf length11 mm

Leaf length max15 mm

Leaf length min7 mm

Leaf mass per area105 g/m2

Leaf size39.71 mm²

Leaf width5 mm

Leaf width max6 mm

Leaf width min2.5 mm

Plant height8 m

Plant height max20 m

Plant height min3 m

Seed length1 mm

Seed mass0.18 mg

⚠ sources differ — TRY: 0.18 mg · AusTraits: 0.04 mg · GIFT: 0.18 mg

Seed mass max0.3 mg

Seed mass min0.06 mg

Seed width1 mm

Life cycle & reproduction9

Deciduousnessevergreen

Flowering timennnnnnnnnnyn

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Habitat GIFTLowland

Leaf compoundnesssimple

Leaf shapeovate widely_ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)9.87 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Melaleuca styphelioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Aromadendrane sesquiterpenoids3

Gallotannins2

Caryophyllane sesquiterpenoids1

Fatty alcohols $ Hydrocarbons1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
1-Dodecen-3-yne	present	LOTUS
3-Decyne	present	LOTUS
3-Methylellagic acid	present	LOTUS
Caryophyllene oxide	present	LOTUS
Ellagic acid	present	LOTUS
Spathulenol	present	LOTUS
Spathulenol, (-)-	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca styphelioides has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF048879.1 ↗280 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAATGACCAGAGAACTAGTAACAAACTCGATGGGGGCGGTGGGCTTCGCCTAACGTCCCCCGACGC …

Melaleuca styphelioides 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Melaleuca styphelioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · book-ipcn75-78 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn75-78 — Brighton 1976

CCDB · book-fedorov — Smith-White 1948a

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 383 records

Wild obs. + sensor4 950

Museum / vouchered400

Cultivated / captive10

Other23

Origin

Native125

Introduced161

Range

Area of Occupancy AOO9 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 3 882≤1 km 683≤10 km 208>10 km 31

4 804 georeferenced · 146 without coordinates

Open the mapobservation + sensor4 950

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 58≤1 km 58≤10 km 149>10 km 37

302 georeferenced · 98 without coordinates

Open the institutions mapphysical evidence400

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 9 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	127
Brisbane, AU	51
Canberra, AU	47
Museo Entomologico de Leonlocation not on record	36
Armidale, AU	20
Adelaide, AU	14
Rotorua, NZ	11
NSW Dept of Planning, Industry and Environmentlocation not on record	10
Tampa, US	10
Cape Town, ZA	8
Wollongong, AU	7
Hobart, AU	6
Kew, GB	5
Auckland, NZ	4
BISHlocation not on record	4
Smithfield, AU	4
Riverside, US	3
Bronx, US	2
Honolulu, US	2
Ivano-Frankivsk, UA	2
Christchurch, NZ	2
Miami, US	2
Davis, US	1
San Luis Obispo, US	1
Long Beach, US	1
San Diego, US	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Vitoria, ES	1
Fort Worth, US	1
Cape Town, ZA	1
Durban, ZA	1
Los Angeles, US	1
Northridge, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Taipei, TW	1
Vancouver, CA	1

36 institutions · 391 of 400 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Melaleuca styphelioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 20.8–20.8

Seasonal swing summer↔winter10.4 °C

Max temp (day)25.9 °C

Min temp (night)16.4 °C

Precipitation90.9 mm/mo

Air humidity57.4 %

Moisture balance-19.5 mm/mo

Vapour deficit1,056 Pa

Wind speed1.90 m/s

Cloud cover26.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca styphelioides

At a glance

Sources11 archives

Size & morphology18

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

Compound class profile4 classes

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type5 383 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions31 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 383 records