Melaleuca stenostachya

S.T.Blake · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records529

Data sources8

Biological traits28

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Melaleuca stenostachya's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility529 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF529 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Melaleuca stenostachya, commonly known as fibre-barked teatree or straight teatree is a plant in the myrtle family Myrtaceae and is native to the Cape York Peninsula in northern Australia, the gulf country of the Northern Territory and the south of Papua New Guinea. It is closely related to Melaleuca dealbata but can be distinguished from that species by the wide separation of the flowers in the inflorescence.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf mass per area156 g/m2

Leaf size150 mm²

Plant height9 m

Seed mass0.13 mg

Seed mass max0.192 mg

Seed mass min0.07 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeynyyyyyyyyny

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Woodinesswoody

Physiology & chemistry6

Leaf c524 mg/g

Leaf dry-matter content (LDMC)856 mg/g

Leaf n12.55 mg/g

Leaf p0.679 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)6.39 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca stenostachya has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH731202.1 ↗519 bpAustralia

ACGT

CCCTCGACGCTTGGATCGCTCGGGCGCCTAGAGCCTCGGGCGTTTCTCGGCGGCATTAACGAACCCCGGCGCGGAATGCGCCAAGGAACT …

Melaleuca stenostachya voucher McDonald1824 haplotype single polymorphic internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS10

plant barcodefungal barcode

08Occurrence & distribution

Record type529 records

Wild obs. + sensor64

Museum / vouchered213

Cultivated / captive3

Other249

Origin

Native30

Range

Area of Occupancy AOO1 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 38≤10 km 2>10 km 1

41 georeferenced · 23 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 23≤1 km 32≤10 km 61>10 km 8

124 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence213

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	65
Mount Annan, AU	29
Kew, GB	23
Museo Entomologico de Leonlocation not on record	13
Armidale, AU	10
Brisbane, AU	6
Palmerston, AU	6
Adelaide, AU	3
James Cook Townsvillelocation not on record	2
Smithfield, AU	2
Taipei, TW	1
John T. Waterhouse Herbariumlocation not on record	1
Kensington, AU	1
Honolulu, US	1
Taipei, TW	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

16 institutions · 165 of 213 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Melaleuca stenostachya was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 21.9–26.8

Seasonal swing summer↔winter6.30 °C

Max temp (day)29.8 °C 26.8–31.8

Min temp (night)21.2 °C 16.1–24.3

Precipitation91.9 mm/mo 43.1–165

Air humidity58.7 % 48.6–61.8

Moisture balance-58.1 mm/mo -108–-9.30

Vapour deficit1,423 Pa 1,144–1,630

Wind speed3.20 m/s 2.50–4.50

Cloud cover48.2 % 29.4–65.2

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)