Melaleuca sieberi

Schauer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records2 770

Data sources8

Biological traits41

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Melaleuca sieberi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 770 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources41 traits

Occurrence & distributionGBIF2 770 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Melaleuca sieberi is a shrub or tree in the myrtle, family Myrtaceae, which is endemic to coastal areas of New South Wales and Queensland. It is a large shrub or small tree with papery bark on the trunk, small, sharp leaves and small heads of fluffy flowers in spring. It should not be confused with Callistemon sieberi. When the callistemons were moved to Melaleuca, Callistemon sieberi became Melaleuca paludicola.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology14

Fruit width3 mm

Leaf length9.5 mm

Leaf length max15 mm

Leaf length min4 mm

Leaf mass per area360 g/m2

Leaf width2.5 mm

Leaf width max4 mm

Leaf width min1 mm

Petiole length0.1 cm

Plant height5 m

Plant height max5 m

Seed mass0.36 mg

Seed mass max0.36 mg

Seed mass min0.36 mg

Life cycle & reproduction8

Deciduousnessevergreen

Flowering timeyynnnnnnnnny

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity2.5 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_elliptical

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry6

Leaf n9.1 mg/g

Leaf p0.3 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.78 mm²/mg

Wood density606 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca sieberi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594303.1 ↗616 bpAustralia · 2018

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGAC …

Melaleuca sieberi voucher 600400481 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1trnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type2 770 records

Wild obs. + sensor2 408

Museum / vouchered251

Cultivated / captive4

Other107

Origin

Native88

Range

Area of Occupancy AOO3 984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 2 061≤1 km 237≤10 km 45>10 km 18

2 361 georeferenced · 47 without coordinates

Open the mapobservation + sensor2 408

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 23≤1 km 43≤10 km 129>10 km 36

231 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence251

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	88
Brisbane, AU	60
Canberra, AU	46
Museo Entomologico de Leonlocation not on record	32
Kew, GB	4
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Hobart, AU	2
Armidale, AU	2
Adelaide, AU	2
Palmerston, AU	2
Kensington, AU	1
University of the Sunshine Coastlocation not on record	1

12 institutions · 242 of 251 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Melaleuca sieberi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 21.2–21.2

Seasonal swing summer↔winter8.70 °C

Max temp (day)23.7 °C

Min temp (night)18.7 °C

Precipitation87.0 mm/mo

Air humidity58.4 %

Vapour deficit1,038 Pa

Cloud cover19.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Melaleuca sieberi

At a glance

Sources8 archives

Size & morphology14

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry6

Other traits1

At a glance

Record type2 770 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 770 records