Melaleuca pustulata

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Melaleuca

At a glance

Occurrence records488

Data sources6

Biological traits23

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Melaleuca pustulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility488 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Occurrence & distributionGBIF488 records

DNA & barcodingNCBIsequences

01Narrative

Melaleuca pustulata, commonly known as yellow paperbark, warty paperbark or Cranbrook paperbark is a plant in the myrtle family, Myrtaceae and is endemic to Tasmania in Australia. It is an uncommon shrub, one of only two melaleucas that are endemic to that state and one of only eight found naturally occurring there. It has thick, pimply leaves, hairy new growth and large numbers of heads of pale yellow, fragrant flowers in spring or early summer.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Leaf length8 mm

Leaf size9.42 mm²

Leaf width1.5 mm

Plant height2.5 m

Seed mass0.03 mg

⚠ sources differ — TRY: 0.03 mg · AusTraits: 0.036 mg · GIFT: 0.03 mg

Seed mass max0.03 mg

Seed mass min0.03 mg

Life cycle & reproduction6

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Melaleuca pustulata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAF048876.1 ↗282 bp

ACGT

ATCATTGTCGAATCCTGCACAGCAGAACGACCAGAGAACCAGTAACAAACTCGACGGGGGCAGCGGGCTCGCCCAATGCCCCCCGACGCT …

Melaleuca pustulata 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type488 records

Wild obs. + sensor414

Museum / vouchered73

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 305≤1 km 46≤10 km 50>10 km 4

405 georeferenced · 9 without coordinates

Open the mapobservation + sensor414

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 2≤1 km 44≤10 km 14>10 km 2

62 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence73

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	44
QVMAGlocation not on record	9
Museo Entomologico de Leonlocation not on record	8
Canberra, AU	7
Mount Annan, AU	2
MAlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Adelaide, AU	1

8 institutions · 73 of 73 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)